EMAIL THIS PAGE TO A FRIEND

LCMT2

leucine carboxyl methyltransferase 2

77 Gene Product Result for
Synonyms: PPM2 TYW4
UniProtKB ID: O60294, Q4JFT6, Q96B55, Q9NR10
Gene ID:
Human(9836) Summary: The protein encoded by this intronless gene belongs to the highly variable methyltransferase superfamily. This gene is the inferred homolog of the Saccharomyces cerevisiae carboxymethyltransferase gene PPM2 that is essential for the synthesis of the hypermodified guanosine Wybutosine (yW). [provided by RefSeq, Jul 2008]
Mouse(329504) leucine carboxyl methyltransferase 2
Rat(296098) leucine carboxyl methyltransferase 2
Zebrafish(100005300) leucine carboxyl methyltransferase 2
cow(538825) leucine carboxyl methyltransferase 2
domestic cat(101100137) leucine carboxyl methyltransferase 2
chicken(419072) leucine carboxyl methyltransferase 2
dog(487524) leucine carboxyl methyltransferase 2
sheep(101110182) leucine carboxyl methyltransferase 2
domestic guinea pig(100724318) leucine carboxyl methyltransferase 2
naked mole-rat(101718972) leucine carboxyl methyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014793 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014793 Rosetta Predictions human pricing
NM_001011956 Rosetta Predictions rat pricing
XM_215816 Rosetta Predictions rat pricing
XM_001003239 Rosetta Predictions mouse pricing
XM_141327 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182503 predicted 2254
2 SASI_Hs01_00182504 predicted 1835
3 SASI_Hs02_00346299 predicted 1291
4 SASI_Hs01_00182505 predicted 2117
5 SASI_Hs01_00182507 predicted 1103
6 SASI_Hs01_00182508 predicted 2008
7 SASI_Hs01_00182510 predicted 1271
8 SASI_Hs01_00182511 predicted 1415
9 SASI_Hs01_00182512 predicted 645
10 SASI_Hs02_00346300 predicted 1025
11 SASI_Hs01_00182506 predicted 1120
12 SASI_Hs01_00182509 predicted 2228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117155 predicted 1133
2 SASI_Rn01_00117157 predicted 1114
3 SASI_Rn01_00117158 predicted 914
4 SASI_Rn01_00117159 predicted 1272
5 SASI_Rn01_00117160 predicted 1011
6 SASI_Rn01_00117161 predicted 947
7 SASI_Rn02_00199972 predicted 1719
8 SASI_Rn01_00117162 predicted 860
9 SASI_Rn01_00117163 predicted 744
10 SASI_Rn01_00117164 predicted 818
11 SASI_Rn01_00117156 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158938 predicted 1094
2 SASI_Rn01_00158939 predicted 1067
3 SASI_Rn01_00158940 predicted 865
4 SASI_Rn01_00158941 predicted 1229
5 SASI_Rn01_00158942 predicted 966
6 SASI_Rn01_00158943 predicted 898
7 SASI_Rn01_00158944 predicted 1679
8 SASI_Rn01_00158945 predicted 818
9 SASI_Rn01_00158946 predicted 696
10 SASI_Rn01_00158947 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355791 predicted 2126
2 SASI_Mm02_00355792 predicted 1351
3 SASI_Mm02_00355793 predicted 1404
4 SASI_Mm02_00355794 predicted 999
5 SASI_Mm02_00355795 predicted 1900
6 SASI_Mm02_00355796 predicted 814
7 SASI_Mm02_00355797 predicted 1400
8 SASI_Mm02_00355798 predicted 197
9 SASI_Mm02_00355799 predicted 1464
10 SASI_Mm02_00355800 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_141327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211882 predicted 2176
2 SASI_Mm01_00211883 predicted 2216
3 SASI_Mm01_00211884 predicted 1114
4 SASI_Mm01_00211885 predicted 1438
5 SASI_Mm01_00211886 predicted 1076
6 SASI_Mm02_00425010 predicted 1981
7 SASI_Mm01_00211887 predicted 898
8 SASI_Mm02_00425011 predicted 282
9 SASI_Mm01_00211889 predicted 1553
10 SASI_Mm01_00211890 predicted 1484
11 SASI_Mm01_00211888 predicted 1484
12 SASI_Mm01_00211891 predicted 1856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014793
LCMT2 MISSION shRNA Bacterial Glycerol Stock
leucine carboxyl methyltransferase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1364s1c1
Sequence:CCGGGCCAGTTTCACTTGCTCTCAACTCGAGTTGAGAGCAAGTGAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014793.3-2686s21c1
Sequence:CCGGTAGTTGAGGGAGCGTAGTATTCTCGAGAATACTACGCTCCCTCAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1454s1c1
Sequence:CCGGGCCTTTATCACACCATGACAACTCGAGTTGTCATGGTGTGATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-2052s1c1
Sequence:CCGGGATCAATTTGACTACAGGATTCTCGAGAATCCTGTAGTCAAATTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1613s1c1
Sequence:CCGGGCCGAAAGGATGATTCCACTTCTCGAGAAGTGGAATCATCCTTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1899s1c1
Sequence:CCGGGAGACCAATCTCTTGTGGATTCTCGAGAATCCACAAGAGATTGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014793.3-2511s21c1
Sequence:CCGGCTAATCTAAGTTCGTTTATTGCTCGAGCAATAAACGAACTTAGATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014793.3-2489s21c1
Sequence:CCGGGTAGTGGTCTGCCTCTAATTTCTCGAGAAATTAGAGGCAGACCACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014793
LCMT2 MISSION shRNA shRNA Plasmid DNA
leucine carboxyl methyltransferase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1364s1c1
Sequence:CCGGGCCAGTTTCACTTGCTCTCAACTCGAGTTGAGAGCAAGTGAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014793.3-2686s21c1
Sequence:CCGGTAGTTGAGGGAGCGTAGTATTCTCGAGAATACTACGCTCCCTCAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1454s1c1
Sequence:CCGGGCCTTTATCACACCATGACAACTCGAGTTGTCATGGTGTGATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-2052s1c1
Sequence:CCGGGATCAATTTGACTACAGGATTCTCGAGAATCCTGTAGTCAAATTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1613s1c1
Sequence:CCGGGCCGAAAGGATGATTCCACTTCTCGAGAAGTGGAATCATCCTTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1899s1c1
Sequence:CCGGGAGACCAATCTCTTGTGGATTCTCGAGAATCCACAAGAGATTGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014793.3-2511s21c1
Sequence:CCGGCTAATCTAAGTTCGTTTATTGCTCGAGCAATAAACGAACTTAGATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014793.3-2489s21c1
Sequence:CCGGGTAGTGGTCTGCCTCTAATTTCTCGAGAAATTAGAGGCAGACCACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014793
LCMT2 MISSION shRNA Lentiviral Transduction Particles
leucine carboxyl methyltransferase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1364s1c1
Sequence:CCGGGCCAGTTTCACTTGCTCTCAACTCGAGTTGAGAGCAAGTGAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014793.3-2686s21c1
Sequence:CCGGTAGTTGAGGGAGCGTAGTATTCTCGAGAATACTACGCTCCCTCAACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1454s1c1
Sequence:CCGGGCCTTTATCACACCATGACAACTCGAGTTGTCATGGTGTGATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-2052s1c1
Sequence:CCGGGATCAATTTGACTACAGGATTCTCGAGAATCCTGTAGTCAAATTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1613s1c1
Sequence:CCGGGCCGAAAGGATGATTCCACTTCTCGAGAAGTGGAATCATCCTTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014793.3-1899s1c1
Sequence:CCGGGAGACCAATCTCTTGTGGATTCTCGAGAATCCACAAGAGATTGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014793.3-2511s21c1
Sequence:CCGGCTAATCTAAGTTCGTTTATTGCTCGAGCAATAAACGAACTTAGATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014793.3-2489s21c1
Sequence:CCGGGTAGTGGTCTGCCTCTAATTTCTCGAGAAATTAGAGGCAGACCACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177846
LCMT2 MISSION shRNA Bacterial Glycerol Stock
leucine carboxyl methyltransferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-1541s21c1
Sequence:CCGGGCATTCAACAACGGAAGTATACTCGAGTATACTTCCGTTGTTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-1189s21c1
Sequence:CCGGTCTTGAGCCCTGGCGTTATTTCTCGAGAAATAACGCCAGGGCTCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-1335s21c1
Sequence:CCGGCAGTGGGATGGACGCCTTTATCTCGAGATAAAGGCGTCCATCCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-2140s21c1
Sequence:CCGGCCTTACGTTCAGGGCAATAAACTCGAGTTTATTGCCCTGAACGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177846.3-3166s21c1
Sequence:CCGGTGAGCTGCATTACGCAATATACTCGAGTATATTGCGTAATGCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177846
LCMT2 MISSION shRNA shRNA Plasmid DNA
leucine carboxyl methyltransferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-1541s21c1
Sequence:CCGGGCATTCAACAACGGAAGTATACTCGAGTATACTTCCGTTGTTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-1189s21c1
Sequence:CCGGTCTTGAGCCCTGGCGTTATTTCTCGAGAAATAACGCCAGGGCTCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-1335s21c1
Sequence:CCGGCAGTGGGATGGACGCCTTTATCTCGAGATAAAGGCGTCCATCCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-2140s21c1
Sequence:CCGGCCTTACGTTCAGGGCAATAAACTCGAGTTTATTGCCCTGAACGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177846.3-3166s21c1
Sequence:CCGGTGAGCTGCATTACGCAATATACTCGAGTATATTGCGTAATGCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177846
LCMT2 MISSION shRNA Lentiviral Transduction Particles
leucine carboxyl methyltransferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-1541s21c1
Sequence:CCGGGCATTCAACAACGGAAGTATACTCGAGTATACTTCCGTTGTTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-1189s21c1
Sequence:CCGGTCTTGAGCCCTGGCGTTATTTCTCGAGAAATAACGCCAGGGCTCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-1335s21c1
Sequence:CCGGCAGTGGGATGGACGCCTTTATCTCGAGATAAAGGCGTCCATCCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177846.3-2140s21c1
Sequence:CCGGCCTTACGTTCAGGGCAATAAACTCGAGTTTATTGCCCTGAACGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177846.3-3166s21c1
Sequence:CCGGTGAGCTGCATTACGCAATATACTCGAGTATATTGCGTAATGCAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)