EMAIL THIS PAGE TO A FRIEND

LCN10

lipocalin 10

51 Gene Product Result for
UniProtKB ID: Q6JVE6, A2RUU3, B0QZ79
Gene ID:
Human(414332) Summary: Members of the lipocalin family, such as LCN10, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]
Mouse(332578) lipocalin 10
Rat(499756) lipocalin 10
dog(100683925) lipocalin 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001712 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001712 Rosetta Predictions human pricing
NM_001128137 Rosetta Predictions rat pricing
NM_178036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239015 predicted 600
2 SASI_Hs02_00303901 predicted 798
3 SASI_Hs02_00303902 predicted 706
4 SASI_Hs02_00303903 predicted 525
5 SASI_Hs02_00303904 predicted 804
6 SASI_Hs02_00303905 predicted 619
7 SASI_Hs02_00303906 predicted 1027
8 SASI_Hs02_00303907 predicted 556
9 SASI_Hs02_00303908 predicted 735
10 SASI_Hs02_00303909 predicted 450
11 SASI_Hs01_00239006 predicted 319
12 SASI_Hs01_00239007 predicted 312
13 SASI_Hs01_00239008 predicted 305
14 SASI_Hs01_00239009 predicted 307
15 SASI_Hs01_00239010 predicted 294
16 SASI_Hs01_00239011 predicted 306
17 SASI_Hs01_00239012 predicted 343
18 SASI_Hs01_00239013 predicted 296
19 SASI_Hs01_00239014 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254970 predicted 759
2 SASI_Rn02_00254971 predicted 351
3 SASI_Rn02_00254972 predicted 198
4 SASI_Rn02_00254973 predicted 636
5 SASI_Rn02_00254974 predicted 711
6 SASI_Rn02_00254975 predicted 583
7 SASI_Rn02_00254976 predicted 515
8 SASI_Rn02_00254977 predicted 797
9 SASI_Rn02_00254978 predicted 853
10 SASI_Rn02_00254979 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111610 predicted 499
2 SASI_Mm01_00111611 predicted 203
3 SASI_Mm01_00111612 predicted 371
4 SASI_Mm01_00111613 predicted 555
5 SASI_Mm01_00111614 predicted 362
6 SASI_Mm01_00111615 predicted 504
7 SASI_Mm01_00111618 predicted 571
8 SASI_Mm01_00111619 predicted 553
9 SASI_Mm02_00348490 predicted 519
10 SASI_Mm02_00348491 predicted 571
11 SASI_Mm01_00111616 predicted 595
12 SASI_Mm01_00111617 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001712
LCN10 MISSION shRNA Bacterial Glycerol Stock
lipocalin 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-100s1c1
Sequence:CCGGGCCCTCAACTGGAACAAGTTTCTCGAGAAACTTGTTCCAGTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-313s1c1
Sequence:CCGGTGGGCATCTCTTTCAGTGAAACTCGAGTTTCACTGAAAGAGATGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-414s1c1
Sequence:CCGGCTACAAGAACCTGCTGCTCTTCTCGAGAAGAGCAGCAGGTTCTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-354s1c1
Sequence:CCGGGCTGTCCACTGACTACAGCTACTCGAGTAGCTGTAGTCAGTGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-201s1c1
Sequence:CCGGGTCCGTGGTAAAGGTGAACAACTCGAGTTGTTCACCTTTACCACGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001712
LCN10 MISSION shRNA shRNA Plasmid DNA
lipocalin 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-100s1c1
Sequence:CCGGGCCCTCAACTGGAACAAGTTTCTCGAGAAACTTGTTCCAGTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-313s1c1
Sequence:CCGGTGGGCATCTCTTTCAGTGAAACTCGAGTTTCACTGAAAGAGATGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-414s1c1
Sequence:CCGGCTACAAGAACCTGCTGCTCTTCTCGAGAAGAGCAGCAGGTTCTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-354s1c1
Sequence:CCGGGCTGTCCACTGACTACAGCTACTCGAGTAGCTGTAGTCAGTGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-201s1c1
Sequence:CCGGGTCCGTGGTAAAGGTGAACAACTCGAGTTGTTCACCTTTACCACGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001712
LCN10 MISSION shRNA Lentiviral Transduction Particles
lipocalin 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-100s1c1
Sequence:CCGGGCCCTCAACTGGAACAAGTTTCTCGAGAAACTTGTTCCAGTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-313s1c1
Sequence:CCGGTGGGCATCTCTTTCAGTGAAACTCGAGTTTCACTGAAAGAGATGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-414s1c1
Sequence:CCGGCTACAAGAACCTGCTGCTCTTCTCGAGAAGAGCAGCAGGTTCTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-354s1c1
Sequence:CCGGGCTGTCCACTGACTACAGCTACTCGAGTAGCTGTAGTCAGTGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001712.1-201s1c1
Sequence:CCGGGTCCGTGGTAAAGGTGAACAACTCGAGTTGTTCACCTTTACCACGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178036
LCN10 MISSION shRNA Bacterial Glycerol Stock
lipocalin 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-563s1c1
Sequence:CCGGCCATCCTTCCGAAAGACGATTCTCGAGAATCGTCTTTCGGAAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-348s1c1
Sequence:CCGGGAAGAGACCTGTGTTCAGGAACTCGAGTTCCTGAACACAGGTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-528s1c1
Sequence:CCGGCACATGTCATATTCTGCAGCTCTCGAGAGCTGCAGAATATGACATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-170s1c1
Sequence:CCGGGCTTCTGGTACATTATTGCCACTCGAGTGGCAATAATGTACCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178036.2-483s1c1
Sequence:CCGGCAGACAGAACATCTCTAGCTTCTCGAGAAGCTAGAGATGTTCTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178036.2-921s1c1
Sequence:CCGGGCTTAGTAGTTAGAGAGTGTACTCGAGTACACTCTCTAACTACTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178036.2-517s1c1
Sequence:CCGGGAATTTCTGGACACATGTCATCTCGAGATGACATGTGTCCAGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178036.2-514s1c1
Sequence:CCGGCGAGAATTTCTGGACACATGTCTCGAGACATGTGTCCAGAAATTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178036.2-972s1c1
Sequence:CCGGCCATATTGTGTGGCAAACGATCTCGAGATCGTTTGCCACACAATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-366s1c1
Sequence:CCGGGAATACCCTCAAGGGAGTAAACTCGAGTTTACTCCCTTGAGGGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178036
LCN10 MISSION shRNA shRNA Plasmid DNA
lipocalin 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-563s1c1
Sequence:CCGGCCATCCTTCCGAAAGACGATTCTCGAGAATCGTCTTTCGGAAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-348s1c1
Sequence:CCGGGAAGAGACCTGTGTTCAGGAACTCGAGTTCCTGAACACAGGTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-528s1c1
Sequence:CCGGCACATGTCATATTCTGCAGCTCTCGAGAGCTGCAGAATATGACATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-170s1c1
Sequence:CCGGGCTTCTGGTACATTATTGCCACTCGAGTGGCAATAATGTACCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178036.2-483s1c1
Sequence:CCGGCAGACAGAACATCTCTAGCTTCTCGAGAAGCTAGAGATGTTCTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178036.2-921s1c1
Sequence:CCGGGCTTAGTAGTTAGAGAGTGTACTCGAGTACACTCTCTAACTACTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178036.2-517s1c1
Sequence:CCGGGAATTTCTGGACACATGTCATCTCGAGATGACATGTGTCCAGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178036.2-514s1c1
Sequence:CCGGCGAGAATTTCTGGACACATGTCTCGAGACATGTGTCCAGAAATTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178036.2-972s1c1
Sequence:CCGGCCATATTGTGTGGCAAACGATCTCGAGATCGTTTGCCACACAATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-366s1c1
Sequence:CCGGGAATACCCTCAAGGGAGTAAACTCGAGTTTACTCCCTTGAGGGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178036
LCN10 MISSION shRNA Lentiviral Transduction Particles
lipocalin 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-563s1c1
Sequence:CCGGCCATCCTTCCGAAAGACGATTCTCGAGAATCGTCTTTCGGAAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-348s1c1
Sequence:CCGGGAAGAGACCTGTGTTCAGGAACTCGAGTTCCTGAACACAGGTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-528s1c1
Sequence:CCGGCACATGTCATATTCTGCAGCTCTCGAGAGCTGCAGAATATGACATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-170s1c1
Sequence:CCGGGCTTCTGGTACATTATTGCCACTCGAGTGGCAATAATGTACCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178036.2-483s1c1
Sequence:CCGGCAGACAGAACATCTCTAGCTTCTCGAGAAGCTAGAGATGTTCTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178036.2-921s1c1
Sequence:CCGGGCTTAGTAGTTAGAGAGTGTACTCGAGTACACTCTCTAACTACTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178036.2-517s1c1
Sequence:CCGGGAATTTCTGGACACATGTCATCTCGAGATGACATGTGTCCAGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178036.2-514s1c1
Sequence:CCGGCGAGAATTTCTGGACACATGTCTCGAGACATGTGTCCAGAAATTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178036.2-972s1c1
Sequence:CCGGCCATATTGTGTGGCAAACGATCTCGAGATCGTTTGCCACACAATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178036.2-366s1c1
Sequence:CCGGGAATACCCTCAAGGGAGTAAACTCGAGTTTACTCCCTTGAGGGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)