EMAIL THIS PAGE TO A FRIEND

LCN12

lipocalin 12

43 Gene Product Result for
UniProtKB ID: Q6JVE5, A2AMJ7
Gene ID:
Human(286256) Summary: Members of the lipocalin family, such as LCN12, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]
Mouse(77701) lipocalin 12
Rat(680602) lipocalin 12
dog(491242) lipocalin 12
cow(789434) lipocalin 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178536 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118551 MISSION® esiRNA esiRNA human LCN12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178536 Rosetta Predictions human pricing
NM_001128138 Rosetta Predictions rat pricing
NM_029958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369773 predicted 276
2 SASI_Hs01_00052458 predicted 359
3 SASI_Hs01_00052459 predicted 423
4 SASI_Hs01_00052460 predicted 226
5 SASI_Hs01_00052461 predicted 270
6 SASI_Hs01_00052462 predicted 392
7 SASI_Hs01_00052463 predicted 371
8 SASI_Hs01_00052465 predicted 268
9 SASI_Hs01_00052466 predicted 226
10 SASI_Hs01_00052467 predicted 428
11 SASI_Hs01_00052464 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254980 predicted 380
2 SASI_Rn02_00254981 predicted 274
3 SASI_Rn02_00254982 predicted 329
4 SASI_Rn02_00254983 predicted 251
5 SASI_Rn02_00254984 predicted 330
6 SASI_Rn02_00254985 predicted 348
7 SASI_Rn02_00254986 predicted 240
8 SASI_Rn02_00254987 predicted 383
9 SASI_Rn02_00254988 predicted 221
10 SASI_Rn02_00254989 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151049 predicted 401
2 SASI_Mm01_00151050 predicted 353
3 SASI_Mm01_00151051 predicted 463
4 SASI_Mm01_00151052 predicted 312
5 SASI_Mm01_00151053 predicted 226
6 SASI_Mm01_00151054 predicted 389
7 SASI_Mm01_00151055 predicted 418
8 SASI_Mm01_00151057 predicted 327
9 SASI_Mm01_00151058 predicted 213
10 SASI_Mm02_00336274 predicted 407
11 SASI_Mm01_00151056 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029958
LCN12 MISSION shRNA Bacterial Glycerol Stock
lipocalin 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-425s1c1
Sequence:CCGGGAGACAGACTACATCACGTTTCTCGAGAAACGTGATGTAGTCTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-141s1c1
Sequence:CCGGCCCAGATGACAAGCTTCCAAACTCGAGTTTGGAAGCTTGTCATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-595s1c1
Sequence:CCGGTCCTGATTTGAGTGACTGGTTCTCGAGAACCAGTCACTCAAATCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-248s1c1
Sequence:CCGGACTACATTGTTTGAGCTGAAACTCGAGTTTCAGCTCAAACAATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-403s1c1
Sequence:CCGGCAGAGAGAATATACAGGTCATCTCGAGATGACCTGTATATTCTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029958
LCN12 MISSION shRNA shRNA Plasmid DNA
lipocalin 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-425s1c1
Sequence:CCGGGAGACAGACTACATCACGTTTCTCGAGAAACGTGATGTAGTCTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-141s1c1
Sequence:CCGGCCCAGATGACAAGCTTCCAAACTCGAGTTTGGAAGCTTGTCATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-595s1c1
Sequence:CCGGTCCTGATTTGAGTGACTGGTTCTCGAGAACCAGTCACTCAAATCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-248s1c1
Sequence:CCGGACTACATTGTTTGAGCTGAAACTCGAGTTTCAGCTCAAACAATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-403s1c1
Sequence:CCGGCAGAGAGAATATACAGGTCATCTCGAGATGACCTGTATATTCTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029958
LCN12 MISSION shRNA Lentiviral Transduction Particles
lipocalin 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-425s1c1
Sequence:CCGGGAGACAGACTACATCACGTTTCTCGAGAAACGTGATGTAGTCTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-141s1c1
Sequence:CCGGCCCAGATGACAAGCTTCCAAACTCGAGTTTGGAAGCTTGTCATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-595s1c1
Sequence:CCGGTCCTGATTTGAGTGACTGGTTCTCGAGAACCAGTCACTCAAATCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-248s1c1
Sequence:CCGGACTACATTGTTTGAGCTGAAACTCGAGTTTCAGCTCAAACAATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029958.1-403s1c1
Sequence:CCGGCAGAGAGAATATACAGGTCATCTCGAGATGACCTGTATATTCTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178536
LCN12 MISSION shRNA Bacterial Glycerol Stock
lipocalin 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-40s21c1
Sequence:CCGGTGGCTCTCCTTGCTGAAAGTCCTCGAGGACTTTCAGCAAGGAGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-535s1c1
Sequence:CCGGGACAACATTGTCTTCCCAGATCTCGAGATCTGGGAAGACAATGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-270s1c1
Sequence:CCGGGCACTGTGACACATGGTCTTACTCGAGTAAGACCATGTGTCACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-549s1c1
Sequence:CCGGCCCAGATGTGACTGGTAACATCTCGAGATGTTACCAGTCACATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-607s1c1
Sequence:CCGGCCCGCAGGAATGAGTTTGGTTCTCGAGAACCAAACTCATTCCTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-221s21c1
Sequence:CCGGTAAGTGATGATGGCCGCTTTGCTCGAGCAAAGCGGCCATCATCACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-103s21c1
Sequence:CCGGATGCAGAGCTTCCAAGGAAACCTCGAGGTTTCCTTGGAAGCTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-195s21c1
Sequence:CCGGGAACGCTTTCACCGCAACTTTCTCGAGAAAGTTGCGGTGAAAGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178536
LCN12 MISSION shRNA shRNA Plasmid DNA
lipocalin 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-40s21c1
Sequence:CCGGTGGCTCTCCTTGCTGAAAGTCCTCGAGGACTTTCAGCAAGGAGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-535s1c1
Sequence:CCGGGACAACATTGTCTTCCCAGATCTCGAGATCTGGGAAGACAATGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-270s1c1
Sequence:CCGGGCACTGTGACACATGGTCTTACTCGAGTAAGACCATGTGTCACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-549s1c1
Sequence:CCGGCCCAGATGTGACTGGTAACATCTCGAGATGTTACCAGTCACATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-607s1c1
Sequence:CCGGCCCGCAGGAATGAGTTTGGTTCTCGAGAACCAAACTCATTCCTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-221s21c1
Sequence:CCGGTAAGTGATGATGGCCGCTTTGCTCGAGCAAAGCGGCCATCATCACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-103s21c1
Sequence:CCGGATGCAGAGCTTCCAAGGAAACCTCGAGGTTTCCTTGGAAGCTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-195s21c1
Sequence:CCGGGAACGCTTTCACCGCAACTTTCTCGAGAAAGTTGCGGTGAAAGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178536
LCN12 MISSION shRNA Lentiviral Transduction Particles
lipocalin 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-40s21c1
Sequence:CCGGTGGCTCTCCTTGCTGAAAGTCCTCGAGGACTTTCAGCAAGGAGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-535s1c1
Sequence:CCGGGACAACATTGTCTTCCCAGATCTCGAGATCTGGGAAGACAATGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-270s1c1
Sequence:CCGGGCACTGTGACACATGGTCTTACTCGAGTAAGACCATGTGTCACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-549s1c1
Sequence:CCGGCCCAGATGTGACTGGTAACATCTCGAGATGTTACCAGTCACATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178536.2-607s1c1
Sequence:CCGGCCCGCAGGAATGAGTTTGGTTCTCGAGAACCAAACTCATTCCTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-221s21c1
Sequence:CCGGTAAGTGATGATGGCCGCTTTGCTCGAGCAAAGCGGCCATCATCACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-103s21c1
Sequence:CCGGATGCAGAGCTTCCAAGGAAACCTCGAGGTTTCCTTGGAAGCTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178536.3-195s21c1
Sequence:CCGGGAACGCTTTCACCGCAACTTTCTCGAGAAAGTTGCGGTGAAAGCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)