EMAIL THIS PAGE TO A FRIEND

LCN15

lipocalin 15

24 Gene Product Result for
Synonyms: PRO6093 UNQ2541
UniProtKB ID: Q6UWW0
Gene ID:
Zebrafish(751703) lipocalin 15
chicken(770666) lipocalin 15
cow(504893) lipocalin 15
dog(607215) lipocalin 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203347 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153931 MISSION® esiRNA esiRNA human LCN15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203347 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222043 predicted 299
2 SASI_Hs01_00222044 predicted 376
3 SASI_Hs01_00222045 predicted 315
4 SASI_Hs01_00222047 predicted 299
5 SASI_Hs02_00373283 predicted 377
6 SASI_Hs01_00222048 predicted 265
7 SASI_Hs01_00222049 predicted 376
8 SASI_Hs01_00222050 predicted 350
9 SASI_Hs01_00222051 predicted 350
10 SASI_Hs02_00373284 predicted 264
11 SASI_Hs01_00222042 predicted 427
12 SASI_Hs01_00222046 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203347
LCN15 MISSION shRNA Bacterial Glycerol Stock
lipocalin 15
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203347.1-154s21c1
Sequence:CCGGATCTGACTGCAGGGTCTTCCTCTCGAGAGGAAGACCCTGCAGTCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-130s1c1
Sequence:CCGGCCTCTGGTACGTGGTCTCCATCTCGAGATGGAGACCACGTACCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-266s1c1
Sequence:CCGGGACGGCTGTAACCAGGTGGATCTCGAGATCCACCTGGTTACAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-475s1c1
Sequence:CCGGGAAGTCCTTCCAGGACTTCTACTCGAGTAGAAGTCCTGGAAGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-388s1c1
Sequence:CCGGCCTTTACATCTACAAGGAGCTCTCGAGAGCTCCTTGTAGATGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-382s1c1
Sequence:CCGGCGCCGTCCTTTACATCTACAACTCGAGTTGTAGATGTAAAGGACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203347.1-180s21c1
Sequence:CCGGAGAAGGACCACCTGTCCATGTCTCGAGACATGGACAGGTGGTCCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203347
LCN15 MISSION shRNA shRNA Plasmid DNA
lipocalin 15
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203347.1-154s21c1
Sequence:CCGGATCTGACTGCAGGGTCTTCCTCTCGAGAGGAAGACCCTGCAGTCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-130s1c1
Sequence:CCGGCCTCTGGTACGTGGTCTCCATCTCGAGATGGAGACCACGTACCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-266s1c1
Sequence:CCGGGACGGCTGTAACCAGGTGGATCTCGAGATCCACCTGGTTACAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-475s1c1
Sequence:CCGGGAAGTCCTTCCAGGACTTCTACTCGAGTAGAAGTCCTGGAAGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-388s1c1
Sequence:CCGGCCTTTACATCTACAAGGAGCTCTCGAGAGCTCCTTGTAGATGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-382s1c1
Sequence:CCGGCGCCGTCCTTTACATCTACAACTCGAGTTGTAGATGTAAAGGACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203347.1-180s21c1
Sequence:CCGGAGAAGGACCACCTGTCCATGTCTCGAGACATGGACAGGTGGTCCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203347
LCN15 MISSION shRNA Lentiviral Transduction Particles
lipocalin 15
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203347.1-154s21c1
Sequence:CCGGATCTGACTGCAGGGTCTTCCTCTCGAGAGGAAGACCCTGCAGTCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-130s1c1
Sequence:CCGGCCTCTGGTACGTGGTCTCCATCTCGAGATGGAGACCACGTACCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-266s1c1
Sequence:CCGGGACGGCTGTAACCAGGTGGATCTCGAGATCCACCTGGTTACAGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-475s1c1
Sequence:CCGGGAAGTCCTTCCAGGACTTCTACTCGAGTAGAAGTCCTGGAAGGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-388s1c1
Sequence:CCGGCCTTTACATCTACAAGGAGCTCTCGAGAGCTCCTTGTAGATGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203347.1-382s1c1
Sequence:CCGGCGCCGTCCTTTACATCTACAACTCGAGTTGTAGATGTAAAGGACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203347.1-180s21c1
Sequence:CCGGAGAAGGACCACCTGTCCATGTCTCGAGACATGGACAGGTGGTCCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)