EMAIL THIS PAGE TO A FRIEND

LCN1

lipocalin 1

21 Gene Product Result for
Synonyms: PMFA TLC TP VEGP
Species: Human LCN1(3933), dog LCN1(403830), domestic guinea pig Lcn1(101788041), naked mole-rat Lcn1(101699336)
UniProtKB ID: P31025, Q5T8A1
Gene ID:
Human(3933) Summary: This gene encodes a member of the lipocalin family of small secretory proteins. Lipocalins are extracellular transport proteins that bind to a variety of hydrophobic ligands. The encoded protein is the primary lipid binding protein in tears and is overproduced in response to multiple stimuli including infection and stress. The encoded protein may be a marker for chromosome aneuploidy as well as an autoantigen in Sjogren's syndrome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and two pseudogenes of this gene are also located on the long arm of chromosome 9. [provided by RefSeq, Nov 2011]
dog(403830) lipocalin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002297 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002297 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237935 predicted 352
2 SASI_Hs01_00237936 predicted 262
3 SASI_Hs01_00237937 predicted 262
4 SASI_Hs01_00237938 predicted 478
5 SASI_Hs01_00237939 predicted 381
6 SASI_Hs01_00237940 predicted 379
7 SASI_Hs01_00237941 predicted 358
8 SASI_Hs01_00237942 predicted 384
9 SASI_Hs01_00237943 predicted 356
10 SASI_Hs01_00237944 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002297
LCN1 MISSION shRNA Bacterial Glycerol Stock
lipocalin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002297.2-189s21c1
Sequence:CCGGGGGAGTTCCCTGAGATGAATCCTCGAGGATTCATCTCAGGGAACTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-567s1c1
Sequence:CCGGCCTGCTCTCCAGGGAGCGATTCTCGAGAATCGCTCCCTGGAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-263s1c1
Sequence:CCGGGCCAAGGTCACCATGCTGATACTCGAGTATCAGCATGGTGACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-157s1c1
Sequence:CCGGGACGTGGTATCTGAAGGCCATCTCGAGATGGCCTTCAGATACCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-385s1c1
Sequence:CCGGGCACGTGAAGGACCACTACATCTCGAGATGTAGTGGTCCTTCACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-488s1c1
Sequence:CCGGGCCTTGGAGGACTTTGAGAAACTCGAGTTTCTCAAAGTCCTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002297.2-360s21c1
Sequence:CCGGAGCACGTGGCATACATCATCACTCGAGTGATGATGTATGCCACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002297.2-129s21c1
Sequence:CCGGCAGACGAGGAGATTCAGGATGCTCGAGCATCCTGAATCTCCTCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002297
LCN1 MISSION shRNA shRNA Plasmid DNA
lipocalin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002297.2-189s21c1
Sequence:CCGGGGGAGTTCCCTGAGATGAATCCTCGAGGATTCATCTCAGGGAACTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-567s1c1
Sequence:CCGGCCTGCTCTCCAGGGAGCGATTCTCGAGAATCGCTCCCTGGAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-263s1c1
Sequence:CCGGGCCAAGGTCACCATGCTGATACTCGAGTATCAGCATGGTGACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-157s1c1
Sequence:CCGGGACGTGGTATCTGAAGGCCATCTCGAGATGGCCTTCAGATACCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-385s1c1
Sequence:CCGGGCACGTGAAGGACCACTACATCTCGAGATGTAGTGGTCCTTCACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-488s1c1
Sequence:CCGGGCCTTGGAGGACTTTGAGAAACTCGAGTTTCTCAAAGTCCTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002297.2-360s21c1
Sequence:CCGGAGCACGTGGCATACATCATCACTCGAGTGATGATGTATGCCACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002297.2-129s21c1
Sequence:CCGGCAGACGAGGAGATTCAGGATGCTCGAGCATCCTGAATCTCCTCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002297
LCN1 MISSION shRNA Lentiviral Transduction Particles
lipocalin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002297.2-189s21c1
Sequence:CCGGGGGAGTTCCCTGAGATGAATCCTCGAGGATTCATCTCAGGGAACTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-567s1c1
Sequence:CCGGCCTGCTCTCCAGGGAGCGATTCTCGAGAATCGCTCCCTGGAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-263s1c1
Sequence:CCGGGCCAAGGTCACCATGCTGATACTCGAGTATCAGCATGGTGACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-157s1c1
Sequence:CCGGGACGTGGTATCTGAAGGCCATCTCGAGATGGCCTTCAGATACCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-385s1c1
Sequence:CCGGGCACGTGAAGGACCACTACATCTCGAGATGTAGTGGTCCTTCACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002297.2-488s1c1
Sequence:CCGGGCCTTGGAGGACTTTGAGAAACTCGAGTTTCTCAAAGTCCTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002297.2-360s21c1
Sequence:CCGGAGCACGTGGCATACATCATCACTCGAGTGATGATGTATGCCACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002297.2-129s21c1
Sequence:CCGGCAGACGAGGAGATTCAGGATGCTCGAGCATCCTGAATCTCCTCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)