EMAIL THIS PAGE TO A FRIEND

LCN1P1

lipocalin 1 pseudogene 1

10 Gene Product Result for
Synonyms: LCN1L1 bA430N14.2
Species: Human LCN1P1(286310)
UniProtKB ID: Q5VSP4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_208403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_208403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_208403 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017747 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494292 predicted 281
2 SASI_Hs02_00494293 predicted 202
3 SASI_Hs02_00494294 predicted 244
4 SASI_Hs02_00494295 predicted 211
5 SASI_Hs02_00494296 predicted 249
6 SASI_Hs02_00494297 predicted 246
7 SASI_Hs02_00494298 predicted 251
8 SASI_Hs02_00494299 predicted 281
9 SASI_Hs02_00494300 predicted 289
10 SASI_Hs02_00494301 predicted 22
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_208403
LCN1P1 MISSION shRNA Bacterial Glycerol Stock
lipocalin 1 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-292s1c1
Sequence:CCGGGTGCCAGGAGGTGAAGGTCATCTCGAGATGACCTTCACCTCCTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-302s1c1
Sequence:CCGGGTGAAGGTCATCCTGGAGAAACTCGAGTTTCTCCAGGATGACCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-385s1c1
Sequence:CCGGGCACATGAAGGACCACTACATCTCGAGATGTAGTGGTCCTTCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-194s1c1
Sequence:CCGGCTCCCTGAGATGAATCTGGAACTCGAGTTCCAGATTCATCTCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-256s1c1
Sequence:CCGGCCTGGAAGCTAAGGCCACCATCTCGAGATGGTGGCCTTAGCTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_208403
LCN1P1 MISSION shRNA shRNA Plasmid DNA
lipocalin 1 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-292s1c1
Sequence:CCGGGTGCCAGGAGGTGAAGGTCATCTCGAGATGACCTTCACCTCCTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-302s1c1
Sequence:CCGGGTGAAGGTCATCCTGGAGAAACTCGAGTTTCTCCAGGATGACCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-385s1c1
Sequence:CCGGGCACATGAAGGACCACTACATCTCGAGATGTAGTGGTCCTTCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-194s1c1
Sequence:CCGGCTCCCTGAGATGAATCTGGAACTCGAGTTCCAGATTCATCTCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-256s1c1
Sequence:CCGGCCTGGAAGCTAAGGCCACCATCTCGAGATGGTGGCCTTAGCTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_208403
LCN1P1 MISSION shRNA Lentiviral Transduction Particles
lipocalin 1 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-292s1c1
Sequence:CCGGGTGCCAGGAGGTGAAGGTCATCTCGAGATGACCTTCACCTCCTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-302s1c1
Sequence:CCGGGTGAAGGTCATCCTGGAGAAACTCGAGTTTCTCCAGGATGACCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-385s1c1
Sequence:CCGGGCACATGAAGGACCACTACATCTCGAGATGTAGTGGTCCTTCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-194s1c1
Sequence:CCGGCTCCCTGAGATGAATCTGGAACTCGAGTTCCAGATTCATCTCAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208403.3-256s1c1
Sequence:CCGGCCTGGAAGCTAAGGCCACCATCTCGAGATGGTGGCCTTAGCTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)