EMAIL THIS PAGE TO A FRIEND

LCN2

lipocalin 2

56 Gene Product Result for
Synonyms: 24p3 MSFI NGAL
Gene ID:
Mouse(16819) lipocalin 2
Rat(170496) lipocalin 2
dog(491320) lipocalin 2
cow(526639) lipocalin 2
sheep(101121411) lipocalin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005564 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007551 MISSION® esiRNA esiRNA targeting human LCN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005564 Rosetta Predictions human pricing
NM_130741 Rosetta Predictions rat pricing
NM_008491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098236 predicted 317
2 SASI_Hs01_00098237 predicted 240
3 SASI_Hs01_00098238 predicted 479
4 SASI_Hs01_00098239 predicted 441
5 SASI_Hs02_00339828 predicted 537
6 SASI_Hs01_00098241 predicted 553
7 SASI_Hs01_00098242 predicted 496
8 SASI_Hs01_00098243 predicted 483
9 SASI_Hs01_00098244 predicted 554
10 SASI_Hs01_00098245 predicted 467
11 SASI_Hs01_00098240 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108437 predicted 284
2 SASI_Rn01_00108438 predicted 276
3 SASI_Rn01_00108439 predicted 213
4 SASI_Rn01_00108440 predicted 617
5 SASI_Rn01_00108441 predicted 547
6 SASI_Rn01_00108442 predicted 330
7 SASI_Rn01_00108443 predicted 241
8 SASI_Rn01_00108444 predicted 270
9 SASI_Rn01_00108445 predicted 251
10 SASI_Rn02_00267473 predicted 582
11 SASI_Rn01_00108436 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082165 predicted 559
2 SASI_Mm01_00082166 predicted 599
3 SASI_Mm01_00082168 predicted 314
4 SASI_Mm02_00314028 predicted 239
5 SASI_Mm01_00082169 predicted 365
6 SASI_Mm01_00082170 predicted 315
7 SASI_Mm01_00082171 predicted 424
8 SASI_Mm01_00082172 predicted 228
9 SASI_Mm01_00082173 predicted 241
10 SASI_Mm01_00082174 predicted 221
11 SASI_Mm01_00082167 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005564
LCN2 MISSION shRNA Bacterial Glycerol Stock
lipocalin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-426s1c1
Sequence:CCGGGCTGGGCAACATTAAGAGTTACTCGAGTAACTCTTAATGTTGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-495s1c1
Sequence:CCGGCCAGCATGCTATGGTGTTCTTCTCGAGAAGAACACCATAGCATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-304s1c1
Sequence:CCGGGCCACCATCTATGAGCTGAAACTCGAGTTTCAGCTCATAGATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-654s1c1
Sequence:CCGGTGTCCCAATCGACCAGTGTATCTCGAGATACACTGGTCGATTGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-540s1c1
Sequence:CCGGGTACTTCAAGATCACCCTCTACTCGAGTAGAGGGTGATCTTGAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005564.3-252s21c1
Sequence:CCGGCAATTCTCAGAGAAGACAAAGCTCGAGCTTTGTCTTCTCTGAGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005564.3-559s21c1
Sequence:CCGGGGAGCTGACTTCGGAACTAAACTCGAGTTTAGTTCCGAAGTCAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005564.3-459s21c1
Sequence:CCGGGAGTGGTGAGCACCAACTACACTCGAGTGTAGTTGGTGCTCACCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005564
LCN2 MISSION shRNA shRNA Plasmid DNA
lipocalin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-426s1c1
Sequence:CCGGGCTGGGCAACATTAAGAGTTACTCGAGTAACTCTTAATGTTGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-495s1c1
Sequence:CCGGCCAGCATGCTATGGTGTTCTTCTCGAGAAGAACACCATAGCATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-304s1c1
Sequence:CCGGGCCACCATCTATGAGCTGAAACTCGAGTTTCAGCTCATAGATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-654s1c1
Sequence:CCGGTGTCCCAATCGACCAGTGTATCTCGAGATACACTGGTCGATTGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-540s1c1
Sequence:CCGGGTACTTCAAGATCACCCTCTACTCGAGTAGAGGGTGATCTTGAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005564.3-252s21c1
Sequence:CCGGCAATTCTCAGAGAAGACAAAGCTCGAGCTTTGTCTTCTCTGAGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005564.3-559s21c1
Sequence:CCGGGGAGCTGACTTCGGAACTAAACTCGAGTTTAGTTCCGAAGTCAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005564.3-459s21c1
Sequence:CCGGGAGTGGTGAGCACCAACTACACTCGAGTGTAGTTGGTGCTCACCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005564
LCN2 MISSION shRNA Lentiviral Transduction Particles
lipocalin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-426s1c1
Sequence:CCGGGCTGGGCAACATTAAGAGTTACTCGAGTAACTCTTAATGTTGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-495s1c1
Sequence:CCGGCCAGCATGCTATGGTGTTCTTCTCGAGAAGAACACCATAGCATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-304s1c1
Sequence:CCGGGCCACCATCTATGAGCTGAAACTCGAGTTTCAGCTCATAGATGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-654s1c1
Sequence:CCGGTGTCCCAATCGACCAGTGTATCTCGAGATACACTGGTCGATTGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005564.2-540s1c1
Sequence:CCGGGTACTTCAAGATCACCCTCTACTCGAGTAGAGGGTGATCTTGAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005564.3-252s21c1
Sequence:CCGGCAATTCTCAGAGAAGACAAAGCTCGAGCTTTGTCTTCTCTGAGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005564.3-559s21c1
Sequence:CCGGGGAGCTGACTTCGGAACTAAACTCGAGTTTAGTTCCGAAGTCAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005564.3-459s21c1
Sequence:CCGGGAGTGGTGAGCACCAACTACACTCGAGTGTAGTTGGTGCTCACCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008491
LCN2 MISSION shRNA Bacterial Glycerol Stock
lipocalin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-523s1c1
Sequence:CCGGCCCTGAACTGAAGGAACGTTTCTCGAGAAACGTTCCTTCAGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-357s1c1
Sequence:CCGGGCCAGTTCACTCTGGGAAATACTCGAGTATTTCCCAGAGTGAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-82s1c1
Sequence:CCGGCCAGGACTCAACTCAGAACTTCTCGAGAAGTTCTGAGTTGAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-317s1c1
Sequence:CCGGCGCTACTGGATCAGAACATTTCTCGAGAAATGTTCTGATCCAGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008491.1-692s1c1
Sequence:CCGGTGCCACTCCATCTTTCCTGTTCTCGAGAACAGGAAAGATGGAGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-256s21c1
Sequence:CCGGACAAGAGAACAATAGCTACAACTCGAGTTGTAGCTATTGTTCTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-608s21c1
Sequence:CCGGCAATGCATTGACAACTGAATGCTCGAGCATTCAGTTGTCAATGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-567s21c1
Sequence:CCGGGCCTCAAGGACGACAACATCACTCGAGTGATGTTGTCGTCCTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-217s21c1
Sequence:CCGGAGAAGGCAGCTTTACGATGTACTCGAGTACATCGTAAAGCTGCCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008491
LCN2 MISSION shRNA shRNA Plasmid DNA
lipocalin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-523s1c1
Sequence:CCGGCCCTGAACTGAAGGAACGTTTCTCGAGAAACGTTCCTTCAGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-357s1c1
Sequence:CCGGGCCAGTTCACTCTGGGAAATACTCGAGTATTTCCCAGAGTGAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-82s1c1
Sequence:CCGGCCAGGACTCAACTCAGAACTTCTCGAGAAGTTCTGAGTTGAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-317s1c1
Sequence:CCGGCGCTACTGGATCAGAACATTTCTCGAGAAATGTTCTGATCCAGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008491.1-692s1c1
Sequence:CCGGTGCCACTCCATCTTTCCTGTTCTCGAGAACAGGAAAGATGGAGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-256s21c1
Sequence:CCGGACAAGAGAACAATAGCTACAACTCGAGTTGTAGCTATTGTTCTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-608s21c1
Sequence:CCGGCAATGCATTGACAACTGAATGCTCGAGCATTCAGTTGTCAATGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-567s21c1
Sequence:CCGGGCCTCAAGGACGACAACATCACTCGAGTGATGTTGTCGTCCTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-217s21c1
Sequence:CCGGAGAAGGCAGCTTTACGATGTACTCGAGTACATCGTAAAGCTGCCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008491
LCN2 MISSION shRNA Lentiviral Transduction Particles
lipocalin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-523s1c1
Sequence:CCGGCCCTGAACTGAAGGAACGTTTCTCGAGAAACGTTCCTTCAGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-357s1c1
Sequence:CCGGGCCAGTTCACTCTGGGAAATACTCGAGTATTTCCCAGAGTGAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-82s1c1
Sequence:CCGGCCAGGACTCAACTCAGAACTTCTCGAGAAGTTCTGAGTTGAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008491.1-317s1c1
Sequence:CCGGCGCTACTGGATCAGAACATTTCTCGAGAAATGTTCTGATCCAGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008491.1-692s1c1
Sequence:CCGGTGCCACTCCATCTTTCCTGTTCTCGAGAACAGGAAAGATGGAGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-256s21c1
Sequence:CCGGACAAGAGAACAATAGCTACAACTCGAGTTGTAGCTATTGTTCTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-608s21c1
Sequence:CCGGCAATGCATTGACAACTGAATGCTCGAGCATTCAGTTGTCAATGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-567s21c1
Sequence:CCGGGCCTCAAGGACGACAACATCACTCGAGTGATGTTGTCGTCCTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008491.1-217s21c1
Sequence:CCGGAGAAGGCAGCTTTACGATGTACTCGAGTACATCGTAAAGCTGCCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)