EMAIL THIS PAGE TO A FRIEND

LCN6

lipocalin 6

52 Gene Product Result for
Synonyms: LCN5 UNQ643 hLcn5
UniProtKB ID: P62502, B0QZ80, Q71SF6
Gene ID:
Mouse(620709) lipocalin 6
Rat(414138) lipocalin 6
dog(491247) lipocalin 6
cow(618665) lipocalin 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101325 Anti-LCN6 antibody produced in rabbit affinity isolated antibody canine, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198946 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198946 Rosetta Predictions human pricing
NM_001001519 Rosetta Predictions rat pricing
NM_177840 Rosetta Predictions mouse pricing
XM_885099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142910 predicted 447
2 SASI_Hs01_00142911 predicted 369
3 SASI_Hs01_00142912 predicted 371
4 SASI_Hs01_00142913 predicted 310
5 SASI_Hs01_00142914 predicted 321
6 SASI_Hs01_00142916 predicted 293
7 SASI_Hs02_00372452 predicted 429
8 SASI_Hs01_00142917 predicted 315
9 SASI_Hs01_00142918 predicted 317
10 SASI_Hs02_00372453 predicted 321
11 SASI_Hs01_00142915 predicted 228
12 SASI_Hs01_00142919 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090315 predicted 500
2 SASI_Rn01_00090316 predicted 326
3 SASI_Rn01_00090317 predicted 490
4 SASI_Rn02_00197922 predicted 373
5 SASI_Rn01_00090318 predicted 358
6 SASI_Rn01_00090319 predicted 215
7 SASI_Rn02_00197923 predicted 207
8 SASI_Rn01_00090320 predicted 302
9 SASI_Rn01_00090322 predicted 333
10 SASI_Rn01_00090323 predicted 429
11 SASI_Rn01_00090314 predicted 354
12 SASI_Rn01_00090321 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348299 predicted 360
2 SASI_Mm02_00348300 predicted 209
3 SASI_Mm02_00348301 predicted 323
4 SASI_Mm02_00348302 predicted 462
5 SASI_Mm02_00348303 predicted 384
6 SASI_Mm02_00348304 predicted 474
7 SASI_Mm02_00348305 predicted 295
8 SASI_Mm02_00348306 predicted 448
9 SASI_Mm02_00348307 predicted 336
10 SASI_Mm02_00348308 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268015 predicted 365
2 SASI_Mm01_00268016 predicted 310
3 SASI_Mm01_00268017 predicted 219
4 SASI_Mm01_00268018 predicted 211
5 SASI_Mm01_00268019 predicted 323
6 SASI_Mm01_00268020 predicted 206
7 SASI_Mm01_00268021 predicted 387
8 SASI_Mm01_00268022 predicted 299
9 SASI_Mm01_00268023 predicted 353
10 SASI_Mm01_00268024 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198946
LCN6 MISSION shRNA Bacterial Glycerol Stock
lipocalin 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-331s1c1
Sequence:CCGGGTGTTTGAGAATCCCTCAATACTCGAGTATTGAGGGATTCTCAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-292s1c1
Sequence:CCGGCAGAGTGTCATGGACCTGATACTCGAGTATCAGGTCCATGACACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-387s1c1
Sequence:CCGGCAGAGACTATGCCATCATCTTCTCGAGAAGATGATGGCATAGTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-195s1c1
Sequence:CCGGGAAGGACATGAAGAACGTCGTCTCGAGACGACGTTCTTCATGTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-376s1c1
Sequence:CCGGGCCACCAACTTCAGAGACTATCTCGAGATAGTCTCTGAAGTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198946.2-317s21c1
Sequence:CCGGGAAACTCCGGATGGGTGTTTGCTCGAGCAAACACCCATCCGGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198946.2-339s21c1
Sequence:CCGGGAATCCCTCAATAGGCGTGCTCTCGAGAGCACGCCTATTGAGGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198946.2-563s21c1
Sequence:CCGGCCTGTGCTCACAAGATCCTTCCTCGAGGAAGGATCTTGTGAGCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198946
LCN6 MISSION shRNA shRNA Plasmid DNA
lipocalin 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-331s1c1
Sequence:CCGGGTGTTTGAGAATCCCTCAATACTCGAGTATTGAGGGATTCTCAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-292s1c1
Sequence:CCGGCAGAGTGTCATGGACCTGATACTCGAGTATCAGGTCCATGACACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-387s1c1
Sequence:CCGGCAGAGACTATGCCATCATCTTCTCGAGAAGATGATGGCATAGTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-195s1c1
Sequence:CCGGGAAGGACATGAAGAACGTCGTCTCGAGACGACGTTCTTCATGTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-376s1c1
Sequence:CCGGGCCACCAACTTCAGAGACTATCTCGAGATAGTCTCTGAAGTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198946.2-317s21c1
Sequence:CCGGGAAACTCCGGATGGGTGTTTGCTCGAGCAAACACCCATCCGGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198946.2-339s21c1
Sequence:CCGGGAATCCCTCAATAGGCGTGCTCTCGAGAGCACGCCTATTGAGGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198946.2-563s21c1
Sequence:CCGGCCTGTGCTCACAAGATCCTTCCTCGAGGAAGGATCTTGTGAGCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198946
LCN6 MISSION shRNA Lentiviral Transduction Particles
lipocalin 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-331s1c1
Sequence:CCGGGTGTTTGAGAATCCCTCAATACTCGAGTATTGAGGGATTCTCAAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-292s1c1
Sequence:CCGGCAGAGTGTCATGGACCTGATACTCGAGTATCAGGTCCATGACACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-387s1c1
Sequence:CCGGCAGAGACTATGCCATCATCTTCTCGAGAAGATGATGGCATAGTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-195s1c1
Sequence:CCGGGAAGGACATGAAGAACGTCGTCTCGAGACGACGTTCTTCATGTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198946.2-376s1c1
Sequence:CCGGGCCACCAACTTCAGAGACTATCTCGAGATAGTCTCTGAAGTTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198946.2-317s21c1
Sequence:CCGGGAAACTCCGGATGGGTGTTTGCTCGAGCAAACACCCATCCGGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198946.2-339s21c1
Sequence:CCGGGAATCCCTCAATAGGCGTGCTCTCGAGAGCACGCCTATTGAGGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198946.2-563s21c1
Sequence:CCGGCCTGTGCTCACAAGATCCTTCCTCGAGGAAGGATCTTGTGAGCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177840
LCN6 MISSION shRNA Bacterial Glycerol Stock
lipocalin 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-327s21c1
Sequence:CCGGGAATCCCTCTCTGGGTATATTCTCGAGAATATACCCAGAGAGGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-391s21c1
Sequence:CCGGGTCTTCACACAGCTGGAATTTCTCGAGAAATTCCAGCTGTGTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-465s21c1
Sequence:CCGGCCACGAAGCCATGCAGCTATTCTCGAGAATAGCTGCATGGCTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-218s21c1
Sequence:CCGGCTCTTACTCCAGATAACAAATCTCGAGATTTGTTATCTGGAGTAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-352s21c1
Sequence:CCGGTATCGGGTACTGGGCACTAACCTCGAGGTTAGTGCCCAGTACCCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177840
LCN6 MISSION shRNA shRNA Plasmid DNA
lipocalin 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-327s21c1
Sequence:CCGGGAATCCCTCTCTGGGTATATTCTCGAGAATATACCCAGAGAGGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-391s21c1
Sequence:CCGGGTCTTCACACAGCTGGAATTTCTCGAGAAATTCCAGCTGTGTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-465s21c1
Sequence:CCGGCCACGAAGCCATGCAGCTATTCTCGAGAATAGCTGCATGGCTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-218s21c1
Sequence:CCGGCTCTTACTCCAGATAACAAATCTCGAGATTTGTTATCTGGAGTAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-352s21c1
Sequence:CCGGTATCGGGTACTGGGCACTAACCTCGAGGTTAGTGCCCAGTACCCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177840
LCN6 MISSION shRNA Lentiviral Transduction Particles
lipocalin 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-327s21c1
Sequence:CCGGGAATCCCTCTCTGGGTATATTCTCGAGAATATACCCAGAGAGGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-391s21c1
Sequence:CCGGGTCTTCACACAGCTGGAATTTCTCGAGAAATTCCAGCTGTGTGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-465s21c1
Sequence:CCGGCCACGAAGCCATGCAGCTATTCTCGAGAATAGCTGCATGGCTTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-218s21c1
Sequence:CCGGCTCTTACTCCAGATAACAAATCTCGAGATTTGTTATCTGGAGTAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177840.3-352s21c1
Sequence:CCGGTATCGGGTACTGGGCACTAACCTCGAGGTTAGTGCCCAGTACCCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)