EMAIL THIS PAGE TO A FRIEND

LCN8

lipocalin 8

41 Gene Product Result for
Synonyms: EP17 LCN5
UniProtKB ID: Q6JVE9, A1L4A8, A6NMN9, Q5T5R4
Gene ID:
Human(138307) Summary: Members of the lipocalin family, such as LCN8, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]
Mouse(78076) lipocalin 8
Rat(366008) lipocalin 8
chicken(396393) lipocalin 8
dog(607230) lipocalin 8
cow(101901987) lipocalin 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178469 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178469 Rosetta Predictions human pricing
NM_001128183 Rosetta Predictions rat pricing
NM_033145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174756 predicted 519
2 SASI_Hs01_00174757 predicted 668
3 SASI_Hs01_00174758 predicted 466
4 SASI_Hs01_00174759 predicted 481
5 SASI_Hs01_00174760 predicted 533
6 SASI_Hs01_00174761 predicted 516
7 SASI_Hs01_00174762 predicted 613
8 SASI_Hs01_00174763 predicted 502
9 SASI_Hs01_00174764 predicted 468
10 SASI_Hs01_00174765 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255020 predicted 351
2 SASI_Rn02_00255021 predicted 222
3 SASI_Rn02_00255022 predicted 248
4 SASI_Rn02_00255023 predicted 241
5 SASI_Rn02_00255024 predicted 410
6 SASI_Rn02_00255025 predicted 388
7 SASI_Rn02_00255026 predicted 341
8 SASI_Rn02_00255027 predicted 329
9 SASI_Rn02_00255028 predicted 374
10 SASI_Rn02_00255029 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029510 predicted 243
2 SASI_Mm01_00029511 predicted 351
3 SASI_Mm01_00029512 predicted 217
4 SASI_Mm01_00029513 predicted 246
5 SASI_Mm01_00029514 predicted 247
6 SASI_Mm01_00029515 predicted 389
7 SASI_Mm01_00029516 predicted 379
8 SASI_Mm01_00029517 predicted 341
9 SASI_Mm01_00029518 predicted 243
10 SASI_Mm01_00029519 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033145
LCN8 MISSION shRNA Bacterial Glycerol Stock
lipocalin 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033145.1-480s21c1
Sequence:CCGGCAGACCAAGGCCTTTACATGTCTCGAGACATGTAAAGGCCTTGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033145.1-189s21c1
Sequence:CCGGAGGGCTTGTTCCTCACCTTCACTCGAGTGAAGGTGAGGAACAAGCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033145.1-50s21c1
Sequence:CCGGTGCGGATTCTTCCTGGTGTTCCTCGAGGAACACCAGGAAGAATCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-266s1c1
Sequence:CCGGGAAAGTTCACTGGGTTCAGAACTCGAGTTCTGAACCCAGTGAACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-105s1c1
Sequence:CCGGTACCAGAGAAGATTGCAGGATCTCGAGATCCTGCAATCTTCTCTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-454s1c1
Sequence:CCGGCTTCTGGCTGTTCCGGGAAATCTCGAGATTTCCCGGAACAGCCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-396s1c1
Sequence:CCGGGAAACTTCCATGTGCTCAAGTCTCGAGACTTGAGCACATGGAAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-223s1c1
Sequence:CCGGCACTGTGAAAGCCGTGTACAACTCGAGTTGTACACGGCTTTCACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033145
LCN8 MISSION shRNA shRNA Plasmid DNA
lipocalin 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033145.1-480s21c1
Sequence:CCGGCAGACCAAGGCCTTTACATGTCTCGAGACATGTAAAGGCCTTGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033145.1-189s21c1
Sequence:CCGGAGGGCTTGTTCCTCACCTTCACTCGAGTGAAGGTGAGGAACAAGCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033145.1-50s21c1
Sequence:CCGGTGCGGATTCTTCCTGGTGTTCCTCGAGGAACACCAGGAAGAATCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-266s1c1
Sequence:CCGGGAAAGTTCACTGGGTTCAGAACTCGAGTTCTGAACCCAGTGAACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-105s1c1
Sequence:CCGGTACCAGAGAAGATTGCAGGATCTCGAGATCCTGCAATCTTCTCTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-454s1c1
Sequence:CCGGCTTCTGGCTGTTCCGGGAAATCTCGAGATTTCCCGGAACAGCCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-396s1c1
Sequence:CCGGGAAACTTCCATGTGCTCAAGTCTCGAGACTTGAGCACATGGAAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-223s1c1
Sequence:CCGGCACTGTGAAAGCCGTGTACAACTCGAGTTGTACACGGCTTTCACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033145
LCN8 MISSION shRNA Lentiviral Transduction Particles
lipocalin 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033145.1-480s21c1
Sequence:CCGGCAGACCAAGGCCTTTACATGTCTCGAGACATGTAAAGGCCTTGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033145.1-189s21c1
Sequence:CCGGAGGGCTTGTTCCTCACCTTCACTCGAGTGAAGGTGAGGAACAAGCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033145.1-50s21c1
Sequence:CCGGTGCGGATTCTTCCTGGTGTTCCTCGAGGAACACCAGGAAGAATCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-266s1c1
Sequence:CCGGGAAAGTTCACTGGGTTCAGAACTCGAGTTCTGAACCCAGTGAACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-105s1c1
Sequence:CCGGTACCAGAGAAGATTGCAGGATCTCGAGATCCTGCAATCTTCTCTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-454s1c1
Sequence:CCGGCTTCTGGCTGTTCCGGGAAATCTCGAGATTTCCCGGAACAGCCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-396s1c1
Sequence:CCGGGAAACTTCCATGTGCTCAAGTCTCGAGACTTGAGCACATGGAAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033145.1-223s1c1
Sequence:CCGGCACTGTGAAAGCCGTGTACAACTCGAGTTGTACACGGCTTTCACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178469
LCN8 MISSION shRNA Bacterial Glycerol Stock
lipocalin 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-505s1c1
Sequence:CCGGCTCAGGAAGCTGTGAGATAGACTCGAGTCTATCTCACAGCTTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-491s1c1
Sequence:CCGGGTTGCATATAACAGCTCAGGACTCGAGTCCTGAGCTGTTATATGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-483s1c1
Sequence:CCGGCCGTGAAGGTTGCATATAACACTCGAGTGTTATATGCAACCTTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-540s1c1
Sequence:CCGGCAGAAATAGACAGTACGGGAACTCGAGTTCCCGTACTGTCTATTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-673s1c1
Sequence:CCGGGTACTTTACTCGGAGCCTTGACTCGAGTCAAGGCTCCGAGTAAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-526s1c1
Sequence:CCGGGAAGATCGTGGGCTCAGAAATCTCGAGATTTCTGAGCCCACGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178469
LCN8 MISSION shRNA shRNA Plasmid DNA
lipocalin 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-505s1c1
Sequence:CCGGCTCAGGAAGCTGTGAGATAGACTCGAGTCTATCTCACAGCTTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-491s1c1
Sequence:CCGGGTTGCATATAACAGCTCAGGACTCGAGTCCTGAGCTGTTATATGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-483s1c1
Sequence:CCGGCCGTGAAGGTTGCATATAACACTCGAGTGTTATATGCAACCTTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-540s1c1
Sequence:CCGGCAGAAATAGACAGTACGGGAACTCGAGTTCCCGTACTGTCTATTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-673s1c1
Sequence:CCGGGTACTTTACTCGGAGCCTTGACTCGAGTCAAGGCTCCGAGTAAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-526s1c1
Sequence:CCGGGAAGATCGTGGGCTCAGAAATCTCGAGATTTCTGAGCCCACGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178469
LCN8 MISSION shRNA Lentiviral Transduction Particles
lipocalin 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-505s1c1
Sequence:CCGGCTCAGGAAGCTGTGAGATAGACTCGAGTCTATCTCACAGCTTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-491s1c1
Sequence:CCGGGTTGCATATAACAGCTCAGGACTCGAGTCCTGAGCTGTTATATGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-483s1c1
Sequence:CCGGCCGTGAAGGTTGCATATAACACTCGAGTGTTATATGCAACCTTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-540s1c1
Sequence:CCGGCAGAAATAGACAGTACGGGAACTCGAGTTCCCGTACTGTCTATTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-673s1c1
Sequence:CCGGGTACTTTACTCGGAGCCTTGACTCGAGTCAAGGCTCCGAGTAAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178469.3-526s1c1
Sequence:CCGGGAAGATCGTGGGCTCAGAAATCTCGAGATTTCTGAGCCCACGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)