EMAIL THIS PAGE TO A FRIEND

LCN9

lipocalin 9

46 Gene Product Result for
Synonyms: 9230102I19Rik
UniProtKB ID: Q8WX39, C9J5F0, Q6JVE7
Gene ID:
Human(392399) Summary: Members of the lipocalin family, such as LCN9, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]
Mouse(77704) lipocalin 9
Rat(296578) lipocalin 9
sheep(101118602) lipocalin 9
cow(788658) lipocalin 9
dog(607752) lipocalin 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
APREST94206 PrEST Antigen LCN9 Prestige Antigens Powered by Atlas Antibodies New human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001676 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU076931 MISSION® esiRNA esiRNA targeting mouse Lcn9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001676 Rosetta Predictions human pricing
NM_001106560 Rosetta Predictions rat pricing
NM_029959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025134 predicted 203
2 SASI_Hs01_00025135 predicted 200
3 SASI_Hs01_00025136 predicted 206
4 SASI_Hs01_00025137 predicted 200
5 SASI_Hs01_00025138 predicted 193
6 SASI_Hs02_00303878 predicted 260
7 SASI_Hs01_00025139 predicted 300
8 SASI_Hs01_00025140 predicted 199
9 SASI_Hs01_00025141 predicted 214
10 SASI_Hs01_00025142 predicted 199
11 SASI_Hs01_00025143 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220158 predicted 423
2 SASI_Rn02_00220159 predicted 223
3 SASI_Rn02_00220160 predicted 505
4 SASI_Rn02_00220161 predicted 250
5 SASI_Rn02_00220162 predicted 213
6 SASI_Rn02_00220163 predicted 349
7 SASI_Rn02_00220164 predicted 454
8 SASI_Rn02_00220165 predicted 226
9 SASI_Rn02_00220166 predicted 421
10 SASI_Rn02_00220167 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108300 predicted 220
2 SASI_Mm01_00108301 predicted 411
3 SASI_Mm02_00336275 predicted 217
4 SASI_Mm01_00108302 predicted 421
5 SASI_Mm01_00108303 predicted 441
6 SASI_Mm01_00108304 predicted 341
7 SASI_Mm02_00336276 predicted 344
8 SASI_Mm01_00108307 predicted 611
9 SASI_Mm02_00336277 predicted 609
10 SASI_Mm02_00336278 predicted 443
11 SASI_Mm01_00108305 predicted 266
12 SASI_Mm01_00108306 predicted 590
13 SASI_Mm01_00108308 predicted 342
14 SASI_Mm01_00108309 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029959
LCN9 MISSION shRNA Bacterial Glycerol Stock
lipocalin 9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-190s1c1
Sequence:CCGGCGGAACATCAAGCTCTTAAATCTCGAGATTTAAGAGCTTGATGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-479s1c1
Sequence:CCGGGCAATCTATATGGGCTGGACTCTCGAGAGTCCAGCCCATATAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029959.1-617s1c1
Sequence:CCGGGCATTAGGCATCCTCTTTCTTCTCGAGAAGAAAGAGGATGCCTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-348s1c1
Sequence:CCGGGACCGACTACAGCATGTATATCTCGAGATATACATGCTGTAGTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-218s1c1
Sequence:CCGGGCCTGCAGTTTGACTTCCATTCTCGAGAATGGAAGTCAAACTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029959.2-298s21c1
Sequence:CCGGGGAGTTCTCTGTTGCCTATGACTCGAGTCATAGGCAACAGAGAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029959.2-125s21c1
Sequence:CCGGGATTCCATAGCCTCAGATAACCTCGAGGTTATCTGAGGCTATGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029959
LCN9 MISSION shRNA shRNA Plasmid DNA
lipocalin 9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-190s1c1
Sequence:CCGGCGGAACATCAAGCTCTTAAATCTCGAGATTTAAGAGCTTGATGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-479s1c1
Sequence:CCGGGCAATCTATATGGGCTGGACTCTCGAGAGTCCAGCCCATATAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029959.1-617s1c1
Sequence:CCGGGCATTAGGCATCCTCTTTCTTCTCGAGAAGAAAGAGGATGCCTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-348s1c1
Sequence:CCGGGACCGACTACAGCATGTATATCTCGAGATATACATGCTGTAGTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-218s1c1
Sequence:CCGGGCCTGCAGTTTGACTTCCATTCTCGAGAATGGAAGTCAAACTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029959.2-298s21c1
Sequence:CCGGGGAGTTCTCTGTTGCCTATGACTCGAGTCATAGGCAACAGAGAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029959.2-125s21c1
Sequence:CCGGGATTCCATAGCCTCAGATAACCTCGAGGTTATCTGAGGCTATGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029959
LCN9 MISSION shRNA Lentiviral Transduction Particles
lipocalin 9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-190s1c1
Sequence:CCGGCGGAACATCAAGCTCTTAAATCTCGAGATTTAAGAGCTTGATGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-479s1c1
Sequence:CCGGGCAATCTATATGGGCTGGACTCTCGAGAGTCCAGCCCATATAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029959.1-617s1c1
Sequence:CCGGGCATTAGGCATCCTCTTTCTTCTCGAGAAGAAAGAGGATGCCTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-348s1c1
Sequence:CCGGGACCGACTACAGCATGTATATCTCGAGATATACATGCTGTAGTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029959.1-218s1c1
Sequence:CCGGGCCTGCAGTTTGACTTCCATTCTCGAGAATGGAAGTCAAACTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029959.2-298s21c1
Sequence:CCGGGGAGTTCTCTGTTGCCTATGACTCGAGTCATAGGCAACAGAGAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029959.2-125s21c1
Sequence:CCGGGATTCCATAGCCTCAGATAACCTCGAGGTTATCTGAGGCTATGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001676
LCN9 MISSION shRNA Bacterial Glycerol Stock
lipocalin 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-204s1c1
Sequence:CCGGCGGCAGCCTAATATTTGATTTCTCGAGAAATCAAATATTAGGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-66s1c1
Sequence:CCGGCGTTATGCAGAGGAACTACAACTCGAGTTGTAGTTCCTCTGCATAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-180s1c1
Sequence:CCGGCCGGAATATTGAACACTTGAACTCGAGTTCAAGTGTTCAATATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-339s1c1
Sequence:CCGGGACTGACTACAGGCTGTTCATCTCGAGATGAACAGCCTGTAGTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-133s1c1
Sequence:CCGGGATGACCTGAATCGGATTAAACTCGAGTTTAATCCGATTCAGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001676
LCN9 MISSION shRNA shRNA Plasmid DNA
lipocalin 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-204s1c1
Sequence:CCGGCGGCAGCCTAATATTTGATTTCTCGAGAAATCAAATATTAGGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-66s1c1
Sequence:CCGGCGTTATGCAGAGGAACTACAACTCGAGTTGTAGTTCCTCTGCATAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-180s1c1
Sequence:CCGGCCGGAATATTGAACACTTGAACTCGAGTTCAAGTGTTCAATATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-339s1c1
Sequence:CCGGGACTGACTACAGGCTGTTCATCTCGAGATGAACAGCCTGTAGTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-133s1c1
Sequence:CCGGGATGACCTGAATCGGATTAAACTCGAGTTTAATCCGATTCAGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001676
LCN9 MISSION shRNA Lentiviral Transduction Particles
lipocalin 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-204s1c1
Sequence:CCGGCGGCAGCCTAATATTTGATTTCTCGAGAAATCAAATATTAGGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-66s1c1
Sequence:CCGGCGTTATGCAGAGGAACTACAACTCGAGTTGTAGTTCCTCTGCATAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-180s1c1
Sequence:CCGGCCGGAATATTGAACACTTGAACTCGAGTTCAAGTGTTCAATATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-339s1c1
Sequence:CCGGGACTGACTACAGGCTGTTCATCTCGAGATGAACAGCCTGTAGTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001676.1-133s1c1
Sequence:CCGGGATGACCTGAATCGGATTAAACTCGAGTTTAATCCGATTCAGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)