EMAIL THIS PAGE TO A FRIEND

LCNL1

lipocalin-like 1

25 Gene Product Result for
UniProtKB ID: Q6ZST4
Gene ID:
naked mole-rat(101700546) lipocalin-like 1
cow(514980) lipocalin-like 1
dog(480671) lipocalin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207510 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220911 MISSION® esiRNA esiRNA targeting human LCNL1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207510 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374134 predicted 1447
2 SASI_Hs02_00374135 predicted 1487
3 SASI_Hs02_00374136 predicted 795
4 SASI_Hs02_00374137 predicted 1476
5 SASI_Hs01_00220538 predicted 647
6 SASI_Hs02_00374138 predicted 738
7 SASI_Hs02_00374139 predicted 1521
8 SASI_Hs02_00374140 predicted 688
9 SASI_Hs01_00220542 predicted 685
10 SASI_Hs01_00220543 predicted 621
11 SASI_Hs01_00220537 predicted 1651
12 SASI_Hs01_00220539 predicted 1358
13 SASI_Hs01_00220540 predicted 1251
14 SASI_Hs01_00220541 predicted 1409
15 SASI_Hs01_00220544 predicted 1700
16 SASI_Hs01_00220545 predicted 1364
17 SASI_Hs01_00220546 predicted 1856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207510
LCNL1 MISSION shRNA Bacterial Glycerol Stock
lipocalin-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2387s1c1
Sequence:CCGGGTGCCTGTGAACAGGTACTTACTCGAGTAAGTACCTGTTCACAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2389s1c1
Sequence:CCGGGCCTGTGAACAGGTACTTAATCTCGAGATTAAGTACCTGTTCACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2390s1c1
Sequence:CCGGCCTGTGAACAGGTACTTAATACTCGAGTATTAAGTACCTGTTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2071s1c1
Sequence:CCGGCTCTGTGTATGTGTGTCTATTCTCGAGAATAGACACACATACACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-3159s1c1
Sequence:CCGGGTCACTCCACTGATCTCAGATCTCGAGATCTGAGATCAGTGGAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-3170s1c1
Sequence:CCGGGATCTCAGATTCGGGACAGAACTCGAGTTCTGTCCCGAATCTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2064s1c1
Sequence:CCGGGCTGTGTCTCTGTGTATGTGTCTCGAGACACATACACAGAGACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207510
LCNL1 MISSION shRNA shRNA Plasmid DNA
lipocalin-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2387s1c1
Sequence:CCGGGTGCCTGTGAACAGGTACTTACTCGAGTAAGTACCTGTTCACAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2389s1c1
Sequence:CCGGGCCTGTGAACAGGTACTTAATCTCGAGATTAAGTACCTGTTCACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2390s1c1
Sequence:CCGGCCTGTGAACAGGTACTTAATACTCGAGTATTAAGTACCTGTTCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2071s1c1
Sequence:CCGGCTCTGTGTATGTGTGTCTATTCTCGAGAATAGACACACATACACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-3159s1c1
Sequence:CCGGGTCACTCCACTGATCTCAGATCTCGAGATCTGAGATCAGTGGAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-3170s1c1
Sequence:CCGGGATCTCAGATTCGGGACAGAACTCGAGTTCTGTCCCGAATCTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2064s1c1
Sequence:CCGGGCTGTGTCTCTGTGTATGTGTCTCGAGACACATACACAGAGACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207510
LCNL1 MISSION shRNA Lentiviral Transduction Particles
lipocalin-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2387s1c1
Sequence:CCGGGTGCCTGTGAACAGGTACTTACTCGAGTAAGTACCTGTTCACAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2389s1c1
Sequence:CCGGGCCTGTGAACAGGTACTTAATCTCGAGATTAAGTACCTGTTCACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2390s1c1
Sequence:CCGGCCTGTGAACAGGTACTTAATACTCGAGTATTAAGTACCTGTTCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2071s1c1
Sequence:CCGGCTCTGTGTATGTGTGTCTATTCTCGAGAATAGACACACATACACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-3159s1c1
Sequence:CCGGGTCACTCCACTGATCTCAGATCTCGAGATCTGAGATCAGTGGAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-3170s1c1
Sequence:CCGGGATCTCAGATTCGGGACAGAACTCGAGTTCTGTCCCGAATCTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207510.2-2064s1c1
Sequence:CCGGGCTGTGTCTCTGTGTATGTGTCTCGAGACACATACACAGAGACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)