EMAIL THIS PAGE TO A FRIEND

LCOR

ligand dependent nuclear receptor corepressor

251 Gene Product Result for
Synonyms: MLR2
Gene ID:
Human(84458) Summary: LCOR is a transcriptional corepressor widely expressed in fetal and adult tissues that is recruited to agonist-bound nuclear receptors through a single LxxLL motif, also referred to as a nuclear receptor (NR) box (Fernandes et al., 2003 [PubMed 12535528]
Mouse(212391) ligand dependent nuclear receptor corepressor
Rat(365462) ligand dependent nuclear receptor corepressor
Zebrafish(558560) ligand dependent nuclear receptor corepressor
cow(507668) ligand dependent nuclear receptor corepressor
cow(100849063) ligand dependent nuclear receptor corepressor
Horse(100070763) ligand dependent nuclear receptor corepressor
domestic cat(101098011) ligand dependent nuclear receptor corepressor
dog(486817) ligand dependent nuclear receptor corepressor
chicken(423847) ligand dependent nuclear receptor corepressor
domestic guinea pig(100718281) ligand dependent nuclear receptor corepressor
naked mole-rat(101722133) ligand dependent nuclear receptor corepressor
sheep(101112525) ligand dependent nuclear receptor corepressor
Domestic Rabbit(100343926) ligand dependent nuclear receptor corepressor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304337 ANTI-LCOR (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV37513 Anti-Lcor antibody produced in rabbit affinity isolated antibody rabbit, rat, mouse, horse, human, guinea pig, bovine, dog
western blot pricing
HPA057621 Anti-LCOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA031429 Anti-LCOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA031428 Anti-LCOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
HPA038954 Anti-LCOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2107466 Anti-LCOR antibody produced in rabbit affinity isolated antibody human, guinea pig, dog, horse, bovine, mouse, rabbit, rat
western blot pricing
SAB2107467 Anti-LCOR antibody produced in rabbit affinity isolated antibody guinea pig, bovine, human, rat
western blot pricing
HPA077000 Anti-LCOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032440 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068471 MISSION® esiRNA esiRNA human LCOR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032440 Rosetta Predictions human pricing
XM_001054503 Rosetta Predictions rat pricing
XM_345033 Rosetta Predictions rat pricing
NM_172154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034439 predicted 1611
2 SASI_Hs01_00034440 predicted 1680
3 SASI_Hs01_00034441 predicted 1675
4 SASI_Hs01_00034443 predicted 629
5 SASI_Hs01_00034444 predicted 1575
6 SASI_Hs01_00034445 predicted 1457
7 SASI_Hs01_00034446 predicted 1844
8 SASI_Hs01_00034447 predicted 789
9 SASI_Hs01_00034448 predicted 1146
10 SASI_Hs02_00359853 predicted 1136
11 SASI_Hs01_00034442 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276045 predicted 1442
2 SASI_Rn02_00276046 predicted 1884
3 SASI_Rn02_00276047 predicted 1802
4 SASI_Rn02_00276048 predicted 1065
5 SASI_Rn02_00276049 predicted 917
6 SASI_Rn02_00276050 predicted 1009
7 SASI_Rn02_00276051 predicted 964
8 SASI_Rn02_00276052 predicted 2071
9 SASI_Rn02_00276053 predicted 1410
10 SASI_Rn02_00276054 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397881 predicted 666
2 SASI_Rn02_00397882 predicted 963
3 SASI_Rn02_00397883 predicted 251
4 SASI_Rn02_00397884 predicted 663
5 SASI_Rn02_00397885 predicted 639
6 SASI_Rn02_00397886 predicted 407
7 SASI_Rn02_00397887 predicted 651
8 SASI_Rn02_00397888 predicted 1012
9 SASI_Rn02_00397889 predicted 242
10 SASI_Rn02_00397890 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148497 predicted 3769
2 SASI_Mm01_00148498 predicted 3677
3 SASI_Mm01_00148499 predicted 3996
4 SASI_Mm01_00148500 predicted 3913
5 SASI_Mm01_00148501 predicted 2877
6 SASI_Mm01_00148502 predicted 2937
7 SASI_Mm01_00148504 predicted 3883
8 SASI_Mm01_00148505 predicted 2931
9 SASI_Mm02_00343701 predicted 3337
10 SASI_Mm02_00343702 predicted 3823
11 SASI_Mm01_00148503 predicted 4157
12 SASI_Mm01_00148506 predicted 3330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172154
VALIDATED
LCOR MISSION shRNA Bacterial Glycerol Stock
ligand dependent nuclear receptor corepressor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-3416s1c1
Sequence:CCGGGCACTTAATCTTATCCAGGGACTCGAGTCCCTGGATAAGATTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172154.2-4401s1c1
Sequence:CCGGCCTCACAAAGACCAGATACATCTCGAGATGTATCTGGTCTTTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-4086s1c1
Sequence:CCGGCCAGATGTTTCTGTAAAGATTCTCGAGAATCTTTACAGAAACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-2935s1c1
Sequence:CCGGCCAATAGCACAAAGAACCAAACTCGAGTTTGGTTCTTTGTGCTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-3599s1c1
Sequence:CCGGCCATTCATCTCCTGTAGATTTCTCGAGAAATCTACAGGAGATGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172154.4-3415s21c1
Sequence:CCGGGCACTTAATCTTATCCAGGGACTCGAGTCCCTGGATAAGATTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172154.4-4085s21c1
Sequence:CCGGCCAGATGTTTCTGTAAAGATTCTCGAGAATCTTTACAGAAACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172154.4-3598s21c1
Sequence:CCGGCCATTCATCTCCTGTAGATTTCTCGAGAAATCTACAGGAGATGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172154.4-4400s21c1
Sequence:CCGGCCTCACAAAGACCAGATACATCTCGAGATGTATCTGGTCTTTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172154
VALIDATED
LCOR MISSION shRNA shRNA Plasmid DNA
ligand dependent nuclear receptor corepressor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-3416s1c1
Sequence:CCGGGCACTTAATCTTATCCAGGGACTCGAGTCCCTGGATAAGATTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172154.2-4401s1c1
Sequence:CCGGCCTCACAAAGACCAGATACATCTCGAGATGTATCTGGTCTTTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-4086s1c1
Sequence:CCGGCCAGATGTTTCTGTAAAGATTCTCGAGAATCTTTACAGAAACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-2935s1c1
Sequence:CCGGCCAATAGCACAAAGAACCAAACTCGAGTTTGGTTCTTTGTGCTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-3599s1c1
Sequence:CCGGCCATTCATCTCCTGTAGATTTCTCGAGAAATCTACAGGAGATGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172154.4-3415s21c1
Sequence:CCGGGCACTTAATCTTATCCAGGGACTCGAGTCCCTGGATAAGATTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172154.4-4085s21c1
Sequence:CCGGCCAGATGTTTCTGTAAAGATTCTCGAGAATCTTTACAGAAACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172154.4-3598s21c1
Sequence:CCGGCCATTCATCTCCTGTAGATTTCTCGAGAAATCTACAGGAGATGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172154.4-4400s21c1
Sequence:CCGGCCTCACAAAGACCAGATACATCTCGAGATGTATCTGGTCTTTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172154
VALIDATED
LCOR MISSION shRNA Lentiviral Transduction Particles
ligand dependent nuclear receptor corepressor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-3416s1c1
Sequence:CCGGGCACTTAATCTTATCCAGGGACTCGAGTCCCTGGATAAGATTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172154.2-4401s1c1
Sequence:CCGGCCTCACAAAGACCAGATACATCTCGAGATGTATCTGGTCTTTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-4086s1c1
Sequence:CCGGCCAGATGTTTCTGTAAAGATTCTCGAGAATCTTTACAGAAACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-2935s1c1
Sequence:CCGGCCAATAGCACAAAGAACCAAACTCGAGTTTGGTTCTTTGTGCTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172154.2-3599s1c1
Sequence:CCGGCCATTCATCTCCTGTAGATTTCTCGAGAAATCTACAGGAGATGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172154.4-3415s21c1
Sequence:CCGGGCACTTAATCTTATCCAGGGACTCGAGTCCCTGGATAAGATTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172154.4-4085s21c1
Sequence:CCGGCCAGATGTTTCTGTAAAGATTCTCGAGAATCTTTACAGAAACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172154.4-3598s21c1
Sequence:CCGGCCATTCATCTCCTGTAGATTTCTCGAGAAATCTACAGGAGATGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172154.4-4400s21c1
Sequence:CCGGCCTCACAAAGACCAGATACATCTCGAGATGTATCTGGTCTTTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032440
LCOR MISSION shRNA Bacterial Glycerol Stock
ligand dependent nuclear receptor corepressor
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-1770s1c1
Sequence:CCGGGCCAGATGTTTCTGTAAAGATCTCGAGATCTTTACAGAAACATCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-615s1c1
Sequence:CCGGCCAGCCCAATAGCACAAAGAACTCGAGTTCTTTGTGCTATTGGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-788s1c1
Sequence:CCGGGTGTACTTGATCTGTCCACTACTCGAGTAGTGGACAGATCAAGTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-1283s1c1
Sequence:CCGGGCCATTCATCTCCTGTAGATTCTCGAGAATCTACAGGAGATGAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-1657s1c1
Sequence:CCGGGCTCAGAGTATTTATGGGATTCTCGAGAATCCCATAAATACTCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032440.3-1929s21c1
Sequence:CCGGATCATTGCTTGCACGTAATTTCTCGAGAAATTACGTGCAAGCAATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032440
LCOR MISSION shRNA shRNA Plasmid DNA
ligand dependent nuclear receptor corepressor
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-1770s1c1
Sequence:CCGGGCCAGATGTTTCTGTAAAGATCTCGAGATCTTTACAGAAACATCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-615s1c1
Sequence:CCGGCCAGCCCAATAGCACAAAGAACTCGAGTTCTTTGTGCTATTGGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-788s1c1
Sequence:CCGGGTGTACTTGATCTGTCCACTACTCGAGTAGTGGACAGATCAAGTACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-1283s1c1
Sequence:CCGGGCCATTCATCTCCTGTAGATTCTCGAGAATCTACAGGAGATGAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-1657s1c1
Sequence:CCGGGCTCAGAGTATTTATGGGATTCTCGAGAATCCCATAAATACTCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032440.3-1929s21c1
Sequence:CCGGATCATTGCTTGCACGTAATTTCTCGAGAAATTACGTGCAAGCAATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032440
LCOR MISSION shRNA Lentiviral Transduction Particles
ligand dependent nuclear receptor corepressor
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-1770s1c1
Sequence:CCGGGCCAGATGTTTCTGTAAAGATCTCGAGATCTTTACAGAAACATCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-615s1c1
Sequence:CCGGCCAGCCCAATAGCACAAAGAACTCGAGTTCTTTGTGCTATTGGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-788s1c1
Sequence:CCGGGTGTACTTGATCTGTCCACTACTCGAGTAGTGGACAGATCAAGTACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-1283s1c1
Sequence:CCGGGCCATTCATCTCCTGTAGATTCTCGAGAATCTACAGGAGATGAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032440.1-1657s1c1
Sequence:CCGGGCTCAGAGTATTTATGGGATTCTCGAGAATCCCATAAATACTCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032440.3-1929s21c1
Sequence:CCGGATCATTGCTTGCACGTAATTTCTCGAGAAATTACGTGCAAGCAATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)