EMAIL THIS PAGE TO A FRIEND

LCORL

ligand dependent nuclear receptor corepressor-like

157 Gene Product Result for
Synonyms: MLR1
UniProtKB ID: Q8N3X6, Q96NK1
Gene ID:
Human(254251) Summary: This gene encodes a transcription factor that appears to function in spermatogenesis. Polymorphisms in this gene are associated with measures of skeletal frame size and adult height. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(209707) ligand dependent nuclear receptor corepressor-like
Rat(498385) ligand dependent nuclear receptor corepressor-like
sheep(101104320) ligand dependent nuclear receptor corepressor-like
Domestic Rabbit(100347964) ligand dependent nuclear receptor corepressor-like
domestic guinea pig(100718463) ligand dependent nuclear receptor corepressor-like
naked mole-rat(101710065) ligand dependent nuclear receptor corepressor-like
Zebrafish(558430) ligand dependent nuclear receptor corepressor-like
cow(540095) ligand dependent nuclear receptor corepressor-like
Horse(100068577) ligand dependent nuclear receptor corepressor-like
domestic cat(101085286) ligand dependent nuclear receptor corepressor-like
dog(613008) ligand dependent nuclear receptor corepressor-like
chicken(422820) ligand dependent nuclear receptor corepressor-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153686 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153686 Rosetta Predictions human pricing
XM_001058603 Rosetta Predictions rat pricing
XM_573620 Rosetta Predictions rat pricing
NM_172153 Rosetta Predictions mouse pricing
NM_178142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149674 predicted 408
2 SASI_Hs01_00149675 predicted 861
3 SASI_Hs01_00149677 predicted 688
4 SASI_Hs01_00149678 predicted 374
5 SASI_Hs01_00149679 predicted 1023
6 SASI_Hs02_00367398 predicted 555
7 SASI_Hs01_00149681 predicted 300
8 SASI_Hs01_00149682 predicted 953
9 SASI_Hs01_00149683 predicted 540
10 SASI_Hs02_00367399 predicted 886
11 SASI_Hs01_00149676 predicted 467
12 SASI_Hs01_00149680 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290294 predicted 755
2 SASI_Rn02_00290295 predicted 465
3 SASI_Rn02_00290296 predicted 558
4 SASI_Rn02_00290297 predicted 1626
5 SASI_Rn02_00290298 predicted 849
6 SASI_Rn02_00290299 predicted 574
7 SASI_Rn02_00290300 predicted 1452
8 SASI_Rn02_00290301 predicted 867
9 SASI_Rn02_00290302 predicted 523
10 SASI_Rn02_00290303 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400567 predicted 990
2 SASI_Rn02_00400568 predicted 1151
3 SASI_Rn02_00400569 predicted 803
4 SASI_Rn02_00400570 predicted 1117
5 SASI_Rn02_00400571 predicted 519
6 SASI_Rn02_00400572 predicted 304
7 SASI_Rn02_00400573 predicted 605
8 SASI_Rn02_00400574 predicted 1120
9 SASI_Rn02_00400575 predicted 605
10 SASI_Rn02_00400576 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199915 predicted 508
2 SASI_Mm01_00199916 predicted 457
3 SASI_Mm01_00199917 predicted 437
4 SASI_Mm02_00343700 predicted 424
5 SASI_Mm01_00199918 predicted 537
6 SASI_Mm01_00199919 predicted 402
7 SASI_Mm01_00199920 predicted 500
8 SASI_Mm01_00199921 predicted 543
9 SASI_Mm01_00199923 predicted 493
10 SASI_Mm01_00199924 predicted 412
11 SASI_Mm01_00199922 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166946 predicted 458
2 SASI_Mm01_00166947 predicted 409
3 SASI_Mm01_00166948 predicted 387
4 SASI_Mm02_00348600 predicted 371
5 SASI_Mm01_00166949 predicted 489
6 SASI_Mm01_00166950 predicted 364
7 SASI_Mm01_00166951 predicted 447
8 SASI_Mm01_00166952 predicted 495
9 SASI_Mm01_00166954 predicted 447
10 SASI_Mm01_00166955 predicted 364
11 SASI_Mm01_00166953 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172153
VALIDATED
LCORL MISSION shRNA Bacterial Glycerol Stock
ligand dependent nuclear receptor corepressor-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-1687s21c1
Sequence:CCGGCCAAAGCACAAGGAATCTATGCTCGAGCATAGATTCCTTGTGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-918s21c1
Sequence:CCGGTCTGGAGCACTGGACATAAATCTCGAGATTTATGTCCAGTGCTCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172153.3-2179s21c1
Sequence:CCGGTAGTAGTCAATAGCATAAATGCTCGAGCATTTATGCTATTGACTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-1570s21c1
Sequence:CCGGGACTGGACCGGAAAGATAATACTCGAGTATTATCTTTCCGGTCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-1294s21c1
Sequence:CCGGTTCCTCAGCTACGAGTAAATTCTCGAGAATTTACTCGTAGCTGAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172153.1-500s1c1
Sequence:CCGGGATCCTAACATTCCCTTAGTTCTCGAGAACTAAGGGAATGTTAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172153.1-420s1c1
Sequence:CCGGCCCACACTGATAAGATTGAATCTCGAGATTCAATCTTATCAGTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172153.1-513s1c1
Sequence:CCGGCCTTAGTTGCTCAGGAATTAACTCGAGTTAATTCCTGAGCAACTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172153.1-3551s1c1
Sequence:CCGGGCTGTTAACATTACCTGCATACTCGAGTATGCAGGTAATGTTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172153.1-1251s1c1
Sequence:CCGGGCCTTCAATATGAAACTTCAACTCGAGTTGAAGTTTCATATTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172153
VALIDATED
LCORL MISSION shRNA shRNA Plasmid DNA
ligand dependent nuclear receptor corepressor-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-1687s21c1
Sequence:CCGGCCAAAGCACAAGGAATCTATGCTCGAGCATAGATTCCTTGTGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-918s21c1
Sequence:CCGGTCTGGAGCACTGGACATAAATCTCGAGATTTATGTCCAGTGCTCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172153.3-2179s21c1
Sequence:CCGGTAGTAGTCAATAGCATAAATGCTCGAGCATTTATGCTATTGACTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-1570s21c1
Sequence:CCGGGACTGGACCGGAAAGATAATACTCGAGTATTATCTTTCCGGTCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-1294s21c1
Sequence:CCGGTTCCTCAGCTACGAGTAAATTCTCGAGAATTTACTCGTAGCTGAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172153.1-500s1c1
Sequence:CCGGGATCCTAACATTCCCTTAGTTCTCGAGAACTAAGGGAATGTTAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172153.1-420s1c1
Sequence:CCGGCCCACACTGATAAGATTGAATCTCGAGATTCAATCTTATCAGTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172153.1-513s1c1
Sequence:CCGGCCTTAGTTGCTCAGGAATTAACTCGAGTTAATTCCTGAGCAACTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172153.1-3551s1c1
Sequence:CCGGGCTGTTAACATTACCTGCATACTCGAGTATGCAGGTAATGTTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172153.1-1251s1c1
Sequence:CCGGGCCTTCAATATGAAACTTCAACTCGAGTTGAAGTTTCATATTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172153
VALIDATED
LCORL MISSION shRNA Lentiviral Transduction Particles
ligand dependent nuclear receptor corepressor-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-1687s21c1
Sequence:CCGGCCAAAGCACAAGGAATCTATGCTCGAGCATAGATTCCTTGTGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-918s21c1
Sequence:CCGGTCTGGAGCACTGGACATAAATCTCGAGATTTATGTCCAGTGCTCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172153.3-2179s21c1
Sequence:CCGGTAGTAGTCAATAGCATAAATGCTCGAGCATTTATGCTATTGACTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-1570s21c1
Sequence:CCGGGACTGGACCGGAAAGATAATACTCGAGTATTATCTTTCCGGTCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172153.3-1294s21c1
Sequence:CCGGTTCCTCAGCTACGAGTAAATTCTCGAGAATTTACTCGTAGCTGAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172153.1-500s1c1
Sequence:CCGGGATCCTAACATTCCCTTAGTTCTCGAGAACTAAGGGAATGTTAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172153.1-420s1c1
Sequence:CCGGCCCACACTGATAAGATTGAATCTCGAGATTCAATCTTATCAGTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172153.1-513s1c1
Sequence:CCGGCCTTAGTTGCTCAGGAATTAACTCGAGTTAATTCCTGAGCAACTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172153.1-3551s1c1
Sequence:CCGGGCTGTTAACATTACCTGCATACTCGAGTATGCAGGTAATGTTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172153.1-1251s1c1
Sequence:CCGGGCCTTCAATATGAAACTTCAACTCGAGTTGAAGTTTCATATTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153686
VALIDATED
LCORL MISSION shRNA Bacterial Glycerol Stock
ligand dependent nuclear receptor corepressor-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153686.7-1511s21c1
Sequence:CCGGTAAATCTCCTTCAACGTTATACTCGAGTATAACGTTGAAGGAGATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153686.7-1313s21c1
Sequence:CCGGCCCTAAGTTTAAATACGTAATCTCGAGATTACGTATTTAAACTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-800s21c1
Sequence:CCGGGTGTTAGATCTCTCTACAAAGCTCGAGCTTTGTAGAGAGATCTAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-398s21c1
Sequence:CCGGGAAGCAGTCAGTGATTGTATACTCGAGTATACAATCACTGACTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-549s21c1
Sequence:CCGGAGAACTGTGATCCTAACATTCCTCGAGGAATGTTAGGATCACAGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-915s21c1
Sequence:CCGGTGAATGTGTCTGATGAGAATACTCGAGTATTCTCATCAGACACATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153686.4-867s1c1
Sequence:CCGGGCCTTAATCGTCCCATTGAATCTCGAGATTCAATGGGACGATTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153686.4-921s1c1
Sequence:CCGGGCTGTACAGTTCATAACCAAACTCGAGTTTGGTTATGAACTGTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_153686.4-375s1c1
Sequence:CCGGCCAACACTGATAAGATTGAATCTCGAGATTCAATCTTATCAGTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153686.4-878s1c1
Sequence:CCGGCCCATTGAATGGAATCTGAATCTCGAGATTCAGATTCCATTCAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153686.4-199s1c1
Sequence:CCGGGCTACGAAGAGACCTCAGTTTCTCGAGAAACTGAGGTCTCTTCGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153686
VALIDATED
LCORL MISSION shRNA shRNA Plasmid DNA
ligand dependent nuclear receptor corepressor-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153686.7-1511s21c1
Sequence:CCGGTAAATCTCCTTCAACGTTATACTCGAGTATAACGTTGAAGGAGATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153686.7-1313s21c1
Sequence:CCGGCCCTAAGTTTAAATACGTAATCTCGAGATTACGTATTTAAACTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-800s21c1
Sequence:CCGGGTGTTAGATCTCTCTACAAAGCTCGAGCTTTGTAGAGAGATCTAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-398s21c1
Sequence:CCGGGAAGCAGTCAGTGATTGTATACTCGAGTATACAATCACTGACTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-549s21c1
Sequence:CCGGAGAACTGTGATCCTAACATTCCTCGAGGAATGTTAGGATCACAGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-915s21c1
Sequence:CCGGTGAATGTGTCTGATGAGAATACTCGAGTATTCTCATCAGACACATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153686.4-867s1c1
Sequence:CCGGGCCTTAATCGTCCCATTGAATCTCGAGATTCAATGGGACGATTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153686.4-921s1c1
Sequence:CCGGGCTGTACAGTTCATAACCAAACTCGAGTTTGGTTATGAACTGTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_153686.4-375s1c1
Sequence:CCGGCCAACACTGATAAGATTGAATCTCGAGATTCAATCTTATCAGTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153686.4-878s1c1
Sequence:CCGGCCCATTGAATGGAATCTGAATCTCGAGATTCAGATTCCATTCAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153686.4-199s1c1
Sequence:CCGGGCTACGAAGAGACCTCAGTTTCTCGAGAAACTGAGGTCTCTTCGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153686
VALIDATED
LCORL MISSION shRNA Lentiviral Transduction Particles
ligand dependent nuclear receptor corepressor-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153686.7-1511s21c1
Sequence:CCGGTAAATCTCCTTCAACGTTATACTCGAGTATAACGTTGAAGGAGATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153686.7-1313s21c1
Sequence:CCGGCCCTAAGTTTAAATACGTAATCTCGAGATTACGTATTTAAACTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-800s21c1
Sequence:CCGGGTGTTAGATCTCTCTACAAAGCTCGAGCTTTGTAGAGAGATCTAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-398s21c1
Sequence:CCGGGAAGCAGTCAGTGATTGTATACTCGAGTATACAATCACTGACTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-549s21c1
Sequence:CCGGAGAACTGTGATCCTAACATTCCTCGAGGAATGTTAGGATCACAGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153686.7-915s21c1
Sequence:CCGGTGAATGTGTCTGATGAGAATACTCGAGTATTCTCATCAGACACATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153686.4-867s1c1
Sequence:CCGGGCCTTAATCGTCCCATTGAATCTCGAGATTCAATGGGACGATTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153686.4-921s1c1
Sequence:CCGGGCTGTACAGTTCATAACCAAACTCGAGTTTGGTTATGAACTGTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_153686.4-375s1c1
Sequence:CCGGCCAACACTGATAAGATTGAATCTCGAGATTCAATCTTATCAGTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153686.4-878s1c1
Sequence:CCGGCCCATTGAATGGAATCTGAATCTCGAGATTCAGATTCCATTCAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153686.4-199s1c1
Sequence:CCGGGCTACGAAGAGACCTCAGTTTCTCGAGAAACTGAGGTCTCTTCGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)