EMAIL THIS PAGE TO A FRIEND

LCT

lactase

76 Gene Product Result for
Synonyms: LAC LPH LPH1
UniProtKB ID: P09848, Q4ZG58
Gene ID:
Human(3938) Summary: The protein encoded by this gene belongs to the family 1 of glycosyl hydrolases. The protein is integral to plasma membrane and has both phlorizin hydrolase activity and lactase activity. [provided by RefSeq, Jul 2008]
Mouse(226413) lactase
Rat(116569) lactase
cow(514332) lactase
dog(483898) lactase
chicken(424294) lactase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002299 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049931 MISSION® esiRNA esiRNA human LCT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002299 Rosetta Predictions human pricing
XM_001055600 Rosetta Predictions rat pricing
XM_001055660 Rosetta Predictions rat pricing
XM_341115 Rosetta Predictions rat pricing
NM_001081078 Rosetta Predictions mouse pricing
XM_129479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077388 predicted 609
2 SASI_Hs02_00333598 predicted 5789
3 SASI_Hs01_00077389 predicted 5855
4 SASI_Hs01_00077390 predicted 4215
5 SASI_Hs02_00333599 predicted 2319
6 SASI_Hs01_00077393 predicted 1101
7 SASI_Hs01_00077395 predicted 3269
8 SASI_Hs01_00077396 predicted 5229
9 SASI_Hs02_00333600 predicted 2418
10 SASI_Hs01_00077397 predicted 5767
11 SASI_Hs01_00077391 predicted 3214
12 SASI_Hs01_00077392 predicted 3532
13 SASI_Hs01_00077394 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280241 predicted 4194
2 SASI_Rn02_00280242 predicted 3979
3 SASI_Rn02_00280243 predicted 4393
4 SASI_Rn02_00280244 predicted 2436
5 SASI_Rn02_00280245 predicted 3274
6 SASI_Rn02_00280246 predicted 3478
7 SASI_Rn02_00280247 predicted 4513
8 SASI_Rn02_00280248 predicted 1412
9 SASI_Rn02_00280249 predicted 4242
10 SASI_Rn02_00280250 predicted 2871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280531 predicted 4237
2 SASI_Rn02_00280532 predicted 702
3 SASI_Rn02_00280533 predicted 4013
4 SASI_Rn02_00280534 predicted 4432
5 SASI_Rn02_00280535 predicted 2473
6 SASI_Rn02_00280536 predicted 3317
7 SASI_Rn02_00280537 predicted 3517
8 SASI_Rn02_00280538 predicted 4555
9 SASI_Rn02_00280539 predicted 1451
10 SASI_Rn02_00280540 predicted 2911
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392401 predicted 4219
2 SASI_Rn02_00392402 predicted 4000
3 SASI_Rn02_00392403 predicted 4417
4 SASI_Rn02_00392404 predicted 2463
5 SASI_Rn02_00392405 predicted 3297
6 SASI_Rn02_00392406 predicted 3503
7 SASI_Rn02_00392407 predicted 4543
8 SASI_Rn02_00392408 predicted 1436
9 SASI_Rn02_00392409 predicted 4261
10 SASI_Rn02_00392410 predicted 2900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294961 predicted 5238
2 SASI_Mm02_00294962 predicted 3501
3 SASI_Mm02_00294963 predicted 2900
4 SASI_Mm02_00294964 predicted 4007
5 SASI_Mm02_00294965 predicted 3299
6 SASI_Mm02_00294966 predicted 2467
7 SASI_Mm02_00294967 predicted 2034
8 SASI_Mm02_00294968 predicted 4551
9 SASI_Mm02_00294969 predicted 1773
10 SASI_Mm02_00294970 predicted 4015
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247046 predicted 5520
2 SASI_Mm01_00247047 predicted 5520
3 SASI_Mm01_00247048 predicted 5522
4 SASI_Mm01_00247049 predicted 5506
5 SASI_Mm01_00247050 predicted 5474
6 SASI_Mm01_00247051 predicted 5508
7 SASI_Mm01_00247052 predicted 5479
8 SASI_Mm01_00247053 predicted 5463
9 SASI_Mm01_00247054 predicted 5472
10 SASI_Mm01_00247055 predicted 5534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002299
VALIDATED
LCT MISSION shRNA Bacterial Glycerol Stock
lactase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002299.2-3117s1c1
Sequence:CCGGCCTGCCTTGATTGACTTGTTTCTCGAGAAACAAGTCAATCAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002299.2-3859s1c1
Sequence:CCGGCGGAGGATACTGATAGGATATCTCGAGATATCCTATCAGTATCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002299.2-4888s1c1
Sequence:CCGGGCTGGTTTGCACATCCTATTTCTCGAGAAATAGGATGTGCAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002299.2-615s1c1
Sequence:CCGGGCCTATGAGATTTACCACGAACTCGAGTTCGTGGTAAATCTCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002299.2-5274s1c1
Sequence:CCGGCGGGAAGAAACAGACCTCAATCTCGAGATTGAGGTCTGTTTCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002299.2-4538s21c1
Sequence:CCGGGACCATCGTGCAGCGGTTTAACTCGAGTTAAACCGCTGCACGATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002299.2-5229s21c1
Sequence:CCGGTACAATGACCCTCCAATTTATCTCGAGATAAATTGGAGGGTCATTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002299.2-5815s21c1
Sequence:CCGGCTATGAAGCAGGCCTAGTTTCCTCGAGGAAACTAGGCCTGCTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002299.2-4774s21c1
Sequence:CCGGCCAGTCAAGGTGGCGTGATTTCTCGAGAAATCACGCCACCTTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002299.2-3861s21c1
Sequence:CCGGGAGGATACTGATAGGATATTTCTCGAGAAATATCCTATCAGTATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002299
VALIDATED
LCT MISSION shRNA shRNA Plasmid DNA
lactase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002299.2-3117s1c1
Sequence:CCGGCCTGCCTTGATTGACTTGTTTCTCGAGAAACAAGTCAATCAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002299.2-3859s1c1
Sequence:CCGGCGGAGGATACTGATAGGATATCTCGAGATATCCTATCAGTATCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002299.2-4888s1c1
Sequence:CCGGGCTGGTTTGCACATCCTATTTCTCGAGAAATAGGATGTGCAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002299.2-615s1c1
Sequence:CCGGGCCTATGAGATTTACCACGAACTCGAGTTCGTGGTAAATCTCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002299.2-5274s1c1
Sequence:CCGGCGGGAAGAAACAGACCTCAATCTCGAGATTGAGGTCTGTTTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002299.2-4538s21c1
Sequence:CCGGGACCATCGTGCAGCGGTTTAACTCGAGTTAAACCGCTGCACGATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002299.2-5229s21c1
Sequence:CCGGTACAATGACCCTCCAATTTATCTCGAGATAAATTGGAGGGTCATTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002299.2-5815s21c1
Sequence:CCGGCTATGAAGCAGGCCTAGTTTCCTCGAGGAAACTAGGCCTGCTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002299.2-4774s21c1
Sequence:CCGGCCAGTCAAGGTGGCGTGATTTCTCGAGAAATCACGCCACCTTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002299.2-3861s21c1
Sequence:CCGGGAGGATACTGATAGGATATTTCTCGAGAAATATCCTATCAGTATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002299
VALIDATED
LCT MISSION shRNA Lentiviral Transduction Particles
lactase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002299.2-3117s1c1
Sequence:CCGGCCTGCCTTGATTGACTTGTTTCTCGAGAAACAAGTCAATCAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002299.2-3859s1c1
Sequence:CCGGCGGAGGATACTGATAGGATATCTCGAGATATCCTATCAGTATCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002299.2-4888s1c1
Sequence:CCGGGCTGGTTTGCACATCCTATTTCTCGAGAAATAGGATGTGCAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002299.2-615s1c1
Sequence:CCGGGCCTATGAGATTTACCACGAACTCGAGTTCGTGGTAAATCTCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002299.2-5274s1c1
Sequence:CCGGCGGGAAGAAACAGACCTCAATCTCGAGATTGAGGTCTGTTTCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002299.2-4538s21c1
Sequence:CCGGGACCATCGTGCAGCGGTTTAACTCGAGTTAAACCGCTGCACGATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002299.2-5229s21c1
Sequence:CCGGTACAATGACCCTCCAATTTATCTCGAGATAAATTGGAGGGTCATTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002299.2-5815s21c1
Sequence:CCGGCTATGAAGCAGGCCTAGTTTCCTCGAGGAAACTAGGCCTGCTTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002299.2-4774s21c1
Sequence:CCGGCCAGTCAAGGTGGCGTGATTTCTCGAGAAATCACGCCACCTTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002299.2-3861s21c1
Sequence:CCGGGAGGATACTGATAGGATATTTCTCGAGAAATATCCTATCAGTATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081078
LCT MISSION shRNA Bacterial Glycerol Stock
lactase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-3687s21c1
Sequence:CCGGGAACCCACCCAGCTATGATAACTCGAGTTATCATAGCTGGGTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-464s21c1
Sequence:CCGGCTGACCTCTTTGCTGATTATGCTCGAGCATAATCAGCAAAGAGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-5243s21c1
Sequence:CCGGAGTACAACAACCCTCTAATTTCTCGAGAAATTAGAGGGTTGTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-3241s21c1
Sequence:CCGGGGCTACAGTTCAGGGATATTCCTCGAGGAATATCCCTGAACTGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081078.1-5904s21c1
Sequence:CCGGTGCACCGCTGGAGGTAATTTCCTCGAGGAAATTACCTCCAGCGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081078
LCT MISSION shRNA shRNA Plasmid DNA
lactase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-3687s21c1
Sequence:CCGGGAACCCACCCAGCTATGATAACTCGAGTTATCATAGCTGGGTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-464s21c1
Sequence:CCGGCTGACCTCTTTGCTGATTATGCTCGAGCATAATCAGCAAAGAGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-5243s21c1
Sequence:CCGGAGTACAACAACCCTCTAATTTCTCGAGAAATTAGAGGGTTGTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-3241s21c1
Sequence:CCGGGGCTACAGTTCAGGGATATTCCTCGAGGAATATCCCTGAACTGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081078.1-5904s21c1
Sequence:CCGGTGCACCGCTGGAGGTAATTTCCTCGAGGAAATTACCTCCAGCGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081078
LCT MISSION shRNA Lentiviral Transduction Particles
lactase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-3687s21c1
Sequence:CCGGGAACCCACCCAGCTATGATAACTCGAGTTATCATAGCTGGGTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-464s21c1
Sequence:CCGGCTGACCTCTTTGCTGATTATGCTCGAGCATAATCAGCAAAGAGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-5243s21c1
Sequence:CCGGAGTACAACAACCCTCTAATTTCTCGAGAAATTAGAGGGTTGTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081078.1-3241s21c1
Sequence:CCGGGGCTACAGTTCAGGGATATTCCTCGAGGAATATCCCTGAACTGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081078.1-5904s21c1
Sequence:CCGGTGCACCGCTGGAGGTAATTTCCTCGAGGAAATTACCTCCAGCGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)