EMAIL THIS PAGE TO A FRIEND

LCTL

lactase-like

55 Gene Product Result for
Synonyms: KLG KLPH
UniProtKB ID: Q6UWM7
Gene ID:
Human(197021) Summary: This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(235435) lactase-like
Rat(315750) lactase-like
sheep(101102566) lactase-like
cow(518599) lactase-like
Horse(100053000) lactase-like
dog(487611) lactase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207338 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031721 MISSION® esiRNA esiRNA human LCTL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207338 Rosetta Predictions human pricing
NM_001108158 Rosetta Predictions rat pricing
NM_145835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207494 predicted 1662
2 SASI_Hs01_00207495 predicted 1586
3 SASI_Hs01_00207496 predicted 380
4 SASI_Hs01_00207497 predicted 1394
5 SASI_Hs02_00373890 predicted 535
6 SASI_Hs01_00207500 predicted 1540
7 SASI_Hs01_00207501 predicted 1080
8 SASI_Hs01_00207502 predicted 528
9 SASI_Hs02_00373891 predicted 519
10 SASI_Hs02_00373892 predicted 315
11 SASI_Hs01_00207498 predicted 1539
12 SASI_Hs01_00207499 predicted 1520
13 SASI_Hs01_00207503 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235924 predicted 669
2 SASI_Rn02_00235925 predicted 1123
3 SASI_Rn02_00235926 predicted 330
4 SASI_Rn02_00235927 predicted 795
5 SASI_Rn02_00235928 predicted 623
6 SASI_Rn02_00235929 predicted 665
7 SASI_Rn02_00235930 predicted 258
8 SASI_Rn02_00235931 predicted 985
9 SASI_Rn02_00235932 predicted 457
10 SASI_Rn02_00235933 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029031 predicted 341
2 SASI_Mm01_00029032 predicted 1813
3 SASI_Mm02_00341308 predicted 1671
4 SASI_Mm01_00029034 predicted 1023
5 SASI_Mm01_00029035 predicted 669
6 SASI_Mm01_00029036 predicted 938
7 SASI_Mm02_00341309 predicted 1445
8 SASI_Mm01_00029038 predicted 1303
9 SASI_Mm01_00029039 predicted 648
10 SASI_Mm02_00341310 predicted 1358
11 SASI_Mm01_00029030 predicted 1492
12 SASI_Mm01_00029033 predicted 1676
13 SASI_Mm01_00029037 predicted 1691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207338
LCTL MISSION shRNA Bacterial Glycerol Stock
lactase-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-816s21c1
Sequence:CCGGGGCAGCACACCACATCATTAACTCGAGTTAATGATGTGGTGTGCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-928s21c1
Sequence:CCGGGAACCTGTGGACATTAGTAACCTCGAGGTTACTAATGTCCACAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-1538s21c1
Sequence:CCGGATAGATATGGATTCTACTATGCTCGAGCATAGTAGAATCCATATCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-1383s21c1
Sequence:CCGGATTCCACTGTACTCAATTATGCTCGAGCATAATTGAGTACAGTGGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-1791s21c1
Sequence:CCGGCATCACTGCTGTTCTACTAATCTCGAGATTAGTAGAACAGCAGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-1643s1c1
Sequence:CCGGCCAATCCAAGAGAGGTGGAAACTCGAGTTTCCACCTCTCTTGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-888s21c1
Sequence:CCGGGCAAGGTCTGGTGGGAATTTCCTCGAGGAAATTCCCACCAGACCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-507s1c1
Sequence:CCGGGCAGGTGAACAAGAAGGGAATCTCGAGATTCCCTTCTTGTTCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-1110s1c1
Sequence:CCGGCCAGGAGAAGAGCTACATTAACTCGAGTTAATGTAGCTCTTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-1228s1c1
Sequence:CCGGCGTGACTTGATAGAGCTGGTTCTCGAGAACCAGCTCTATCAAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207338
LCTL MISSION shRNA shRNA Plasmid DNA
lactase-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-816s21c1
Sequence:CCGGGGCAGCACACCACATCATTAACTCGAGTTAATGATGTGGTGTGCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-928s21c1
Sequence:CCGGGAACCTGTGGACATTAGTAACCTCGAGGTTACTAATGTCCACAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-1538s21c1
Sequence:CCGGATAGATATGGATTCTACTATGCTCGAGCATAGTAGAATCCATATCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-1383s21c1
Sequence:CCGGATTCCACTGTACTCAATTATGCTCGAGCATAATTGAGTACAGTGGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-1791s21c1
Sequence:CCGGCATCACTGCTGTTCTACTAATCTCGAGATTAGTAGAACAGCAGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-1643s1c1
Sequence:CCGGCCAATCCAAGAGAGGTGGAAACTCGAGTTTCCACCTCTCTTGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-888s21c1
Sequence:CCGGGCAAGGTCTGGTGGGAATTTCCTCGAGGAAATTCCCACCAGACCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-507s1c1
Sequence:CCGGGCAGGTGAACAAGAAGGGAATCTCGAGATTCCCTTCTTGTTCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-1110s1c1
Sequence:CCGGCCAGGAGAAGAGCTACATTAACTCGAGTTAATGTAGCTCTTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-1228s1c1
Sequence:CCGGCGTGACTTGATAGAGCTGGTTCTCGAGAACCAGCTCTATCAAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207338
LCTL MISSION shRNA Lentiviral Transduction Particles
lactase-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-816s21c1
Sequence:CCGGGGCAGCACACCACATCATTAACTCGAGTTAATGATGTGGTGTGCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-928s21c1
Sequence:CCGGGAACCTGTGGACATTAGTAACCTCGAGGTTACTAATGTCCACAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-1538s21c1
Sequence:CCGGATAGATATGGATTCTACTATGCTCGAGCATAGTAGAATCCATATCTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-1383s21c1
Sequence:CCGGATTCCACTGTACTCAATTATGCTCGAGCATAATTGAGTACAGTGGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-1791s21c1
Sequence:CCGGCATCACTGCTGTTCTACTAATCTCGAGATTAGTAGAACAGCAGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-1643s1c1
Sequence:CCGGCCAATCCAAGAGAGGTGGAAACTCGAGTTTCCACCTCTCTTGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207338.2-888s21c1
Sequence:CCGGGCAAGGTCTGGTGGGAATTTCCTCGAGGAAATTCCCACCAGACCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-507s1c1
Sequence:CCGGGCAGGTGAACAAGAAGGGAATCTCGAGATTCCCTTCTTGTTCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-1110s1c1
Sequence:CCGGCCAGGAGAAGAGCTACATTAACTCGAGTTAATGTAGCTCTTCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207338.1-1228s1c1
Sequence:CCGGCGTGACTTGATAGAGCTGGTTCTCGAGAACCAGCTCTATCAAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145835
LCTL MISSION shRNA Bacterial Glycerol Stock
lactase-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145835.1-1987s1c1
Sequence:CCGGCTCTCCACCTTCATCTGTCAACTCGAGTTGACAGATGAAGGTGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-1646s1c1
Sequence:CCGGGATAAGTTTGAATGGGAGAAACTCGAGTTTCTCCCATTCAAACTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-1147s1c1
Sequence:CCGGCCCTATTTACGCTGGTGACTACTCGAGTAGTCACCAGCGTAAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-1305s1c1
Sequence:CCGGCCACTCGATACATCACTCAAACTCGAGTTTGAGTGATGTATCGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-527s1c1
Sequence:CCGGGCCTGTGACAGCTACTATAAACTCGAGTTTATAGTAGCTGTCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145835
LCTL MISSION shRNA shRNA Plasmid DNA
lactase-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145835.1-1987s1c1
Sequence:CCGGCTCTCCACCTTCATCTGTCAACTCGAGTTGACAGATGAAGGTGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-1646s1c1
Sequence:CCGGGATAAGTTTGAATGGGAGAAACTCGAGTTTCTCCCATTCAAACTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-1147s1c1
Sequence:CCGGCCCTATTTACGCTGGTGACTACTCGAGTAGTCACCAGCGTAAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-1305s1c1
Sequence:CCGGCCACTCGATACATCACTCAAACTCGAGTTTGAGTGATGTATCGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-527s1c1
Sequence:CCGGGCCTGTGACAGCTACTATAAACTCGAGTTTATAGTAGCTGTCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145835
LCTL MISSION shRNA Lentiviral Transduction Particles
lactase-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145835.1-1987s1c1
Sequence:CCGGCTCTCCACCTTCATCTGTCAACTCGAGTTGACAGATGAAGGTGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-1646s1c1
Sequence:CCGGGATAAGTTTGAATGGGAGAAACTCGAGTTTCTCCCATTCAAACTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-1147s1c1
Sequence:CCGGCCCTATTTACGCTGGTGACTACTCGAGTAGTCACCAGCGTAAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-1305s1c1
Sequence:CCGGCCACTCGATACATCACTCAAACTCGAGTTTGAGTGATGTATCGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145835.1-527s1c1
Sequence:CCGGGCCTGTGACAGCTACTATAAACTCGAGTTTATAGTAGCTGTCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)