EMAIL THIS PAGE TO A FRIEND

LDB1

LIM domain binding 1

75 Gene Product Result for
Synonyms: CLIM2 NLI
UniProtKB ID: Q86U70, B4DUC4, O75479, O96010, Q1EQX1, Q9UGM4
Gene ID:
Mouse(16825) LIM domain binding 1
Rat(309447) LIM domain binding 1
chicken(395952) LIM domain binding 1
cow(526472) LIM domain binding 1
dog(477804) LIM domain binding 1
domestic cat(101100339) LIM domain binding 1
sheep(101105964) LIM domain binding 1
domestic guinea pig(100720270) LIM domain binding 1
naked mole-rat(101706605) LIM domain binding 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003893 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113407 Rosetta Predictions human pricing
NM_003893 Rosetta Predictions human pricing
NM_001107601 Rosetta Predictions rat pricing
NM_001113408 Rosetta Predictions mouse pricing
NM_010697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325821 predicted 1648
2 SASI_Hs02_00325822 predicted 1223
3 SASI_Hs02_00325823 predicted 641
4 SASI_Hs02_00325824 predicted 738
5 SASI_Hs02_00325825 predicted 777
6 SASI_Hs02_00325826 predicted 713
7 SASI_Hs02_00325827 predicted 717
8 SASI_Hs02_00325828 predicted 1442
9 SASI_Hs02_00325829 predicted 1313
10 SASI_Hs02_00325830 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167846 predicted 1835
2 SASI_Hs02_00336507 predicted 1412
3 SASI_Hs01_00167849 predicted 834
4 SASI_Hs02_00336508 predicted 933
5 SASI_Hs02_00336509 predicted 975
6 SASI_Hs02_00336510 predicted 904
7 SASI_Hs01_00167850 predicted 909
8 SASI_Hs02_00336511 predicted 1634
9 SASI_Hs02_00336512 predicted 1501
10 SASI_Hs02_00336513 predicted 1257
11 SASI_Hs01_00167847 predicted 1095
12 SASI_Hs01_00167848 predicted 1072
13 SASI_Hs01_00167851 predicted 1062
14 SASI_Hs01_00167852 predicted 1172
15 SASI_Hs01_00167853 predicted 1227
16 SASI_Hs01_00167854 predicted 1260
17 SASI_Hs01_00167855 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230445 predicted 820
2 SASI_Rn02_00230446 predicted 719
3 SASI_Rn02_00230447 predicted 1288
4 SASI_Rn02_00230448 predicted 1108
5 SASI_Rn02_00230449 predicted 735
6 SASI_Rn02_00230450 predicted 838
7 SASI_Rn02_00230451 predicted 991
8 SASI_Rn02_00230452 predicted 1078
9 SASI_Rn02_00230453 predicted 668
10 SASI_Rn02_00230454 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307776 predicted 1053
2 SASI_Mm02_00307777 predicted 724
3 SASI_Mm02_00307778 predicted 944
4 SASI_Mm02_00307779 predicted 1544
5 SASI_Mm02_00307780 predicted 1234
6 SASI_Mm02_00307781 predicted 804
7 SASI_Mm02_00307782 predicted 1675
8 SASI_Mm02_00307783 predicted 687
9 SASI_Mm02_00307784 predicted 679
10 SASI_Mm02_00307785 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152977 predicted 1238
2 SASI_Mm01_00152978 predicted 912
3 SASI_Mm01_00152979 predicted 1124
4 SASI_Mm01_00152980 predicted 1726
5 SASI_Mm01_00152981 predicted 1421
6 SASI_Mm01_00152982 predicted 993
7 SASI_Mm02_00319145 predicted 1859
8 SASI_Mm01_00152984 predicted 870
9 SASI_Mm02_00319146 predicted 864
10 SASI_Mm01_00152986 predicted 849
11 SASI_Mm01_00152983 predicted 737
12 SASI_Mm01_00152985 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003893
VALIDATED
LDB1 MISSION shRNA Bacterial Glycerol Stock
LIM domain binding 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003893.3-925s1c1
Sequence:CCGGCGGAGCTGTACTATGTTCTTACTCGAGTAAGAACATAGTACAGCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003893.3-1634s1c1
Sequence:CCGGCGACGAGGACAGCTTTAACAACTCGAGTTGTTAAAGCTGTCCTCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003893.3-706s1c1
Sequence:CCGGGCAACCAAACTGACTACAGAACTCGAGTTCTGTAGTCAGTTTGGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003893.3-1091s1c1
Sequence:CCGGGCGGATAAAGACGTGGCACTTCTCGAGAAGTGCCACGTCTTTATCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003893.3-1217s1c1
Sequence:CCGGGCTGTCCAATTCCACTCTCAACTCGAGTTGAGAGTGGAATTGGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003893.4-913s21c1
Sequence:CCGGGCTACTTCCGCAGCATCTTTGCTCGAGCAAAGATGCTGCGGAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003893.4-869s21c1
Sequence:CCGGGGATGGACCAAAGAGATATACCTCGAGGTATATCTCTTTGGTCCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003893.4-1848s21c1
Sequence:CCGGTGAAGAGACTGAGCATCTAAACTCGAGTTTAGATGCTCAGTCTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003893.4-840s21c1
Sequence:CCGGGCCATGTTGACCATCACTTTCCTCGAGGAAAGTGATGGTCAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003893.4-1655s21c1
Sequence:CCGGCGACGAGGACAGCTTTAACAACTCGAGTTGTTAAAGCTGTCCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003893
VALIDATED
LDB1 MISSION shRNA shRNA Plasmid DNA
LIM domain binding 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003893.3-925s1c1
Sequence:CCGGCGGAGCTGTACTATGTTCTTACTCGAGTAAGAACATAGTACAGCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003893.3-1634s1c1
Sequence:CCGGCGACGAGGACAGCTTTAACAACTCGAGTTGTTAAAGCTGTCCTCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003893.3-706s1c1
Sequence:CCGGGCAACCAAACTGACTACAGAACTCGAGTTCTGTAGTCAGTTTGGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003893.3-1091s1c1
Sequence:CCGGGCGGATAAAGACGTGGCACTTCTCGAGAAGTGCCACGTCTTTATCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003893.3-1217s1c1
Sequence:CCGGGCTGTCCAATTCCACTCTCAACTCGAGTTGAGAGTGGAATTGGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003893.4-913s21c1
Sequence:CCGGGCTACTTCCGCAGCATCTTTGCTCGAGCAAAGATGCTGCGGAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003893.4-869s21c1
Sequence:CCGGGGATGGACCAAAGAGATATACCTCGAGGTATATCTCTTTGGTCCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003893.4-1848s21c1
Sequence:CCGGTGAAGAGACTGAGCATCTAAACTCGAGTTTAGATGCTCAGTCTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003893.4-840s21c1
Sequence:CCGGGCCATGTTGACCATCACTTTCCTCGAGGAAAGTGATGGTCAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003893.4-1655s21c1
Sequence:CCGGCGACGAGGACAGCTTTAACAACTCGAGTTGTTAAAGCTGTCCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003893
VALIDATED
LDB1 MISSION shRNA Lentiviral Transduction Particles
LIM domain binding 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003893.3-925s1c1
Sequence:CCGGCGGAGCTGTACTATGTTCTTACTCGAGTAAGAACATAGTACAGCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003893.3-1634s1c1
Sequence:CCGGCGACGAGGACAGCTTTAACAACTCGAGTTGTTAAAGCTGTCCTCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003893.3-706s1c1
Sequence:CCGGGCAACCAAACTGACTACAGAACTCGAGTTCTGTAGTCAGTTTGGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003893.3-1091s1c1
Sequence:CCGGGCGGATAAAGACGTGGCACTTCTCGAGAAGTGCCACGTCTTTATCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003893.3-1217s1c1
Sequence:CCGGGCTGTCCAATTCCACTCTCAACTCGAGTTGAGAGTGGAATTGGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003893.4-913s21c1
Sequence:CCGGGCTACTTCCGCAGCATCTTTGCTCGAGCAAAGATGCTGCGGAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003893.4-869s21c1
Sequence:CCGGGGATGGACCAAAGAGATATACCTCGAGGTATATCTCTTTGGTCCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003893.4-1848s21c1
Sequence:CCGGTGAAGAGACTGAGCATCTAAACTCGAGTTTAGATGCTCAGTCTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003893.4-840s21c1
Sequence:CCGGGCCATGTTGACCATCACTTTCCTCGAGGAAAGTGATGGTCAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003893.4-1655s21c1
Sequence:CCGGCGACGAGGACAGCTTTAACAACTCGAGTTGTTAAAGCTGTCCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010697
VALIDATED
LDB1 MISSION shRNA Bacterial Glycerol Stock
LIM domain binding 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010697.1-1830s1c1
Sequence:CCGGAGGGAGCAGAAGACGGAATAACTCGAGTTATTCCGTCTTCTGCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010697.1-720s1c1
Sequence:CCGGCACACACCATATGGTAACCAACTCGAGTTGGTTACCATATGGTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010697.1-761s1c1
Sequence:CCGGGCTTAACAAACGGCTACAGAACTCGAGTTCTGTAGCCGTTTGTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010697.1-916s1c1
Sequence:CCGGCACGCTACTTCCGAAGCATTTCTCGAGAAATGCTTCGGAAGTAGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010697.1-1733s1c1
Sequence:CCGGCCAAGAGAGCAAATCGGAGAACTCGAGTTCTCCGATTTGCTCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-916s21c1
Sequence:CCGGCACGCTACTTCCGAAGCATTTCTCGAGAAATGCTTCGGAAGTAGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-1106s21c1
Sequence:CCGGTGACGACATGATGCGGATAAACTCGAGTTTATCCGCATCATGTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-1831s21c1
Sequence:CCGGGGGAGCAGAAGACGGAATAAACTCGAGTTTATTCCGTCTTCTGCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-1042s21c1
Sequence:CCGGAGCACGGCAAACCCATGTTTACTCGAGTAAACATGGGTTTGCCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-730s21c1
Sequence:CCGGATGGTAACCAAACCGACTATACTCGAGTATAGTCGGTTTGGTTACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010697
VALIDATED
LDB1 MISSION shRNA shRNA Plasmid DNA
LIM domain binding 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010697.1-1830s1c1
Sequence:CCGGAGGGAGCAGAAGACGGAATAACTCGAGTTATTCCGTCTTCTGCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010697.1-720s1c1
Sequence:CCGGCACACACCATATGGTAACCAACTCGAGTTGGTTACCATATGGTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010697.1-761s1c1
Sequence:CCGGGCTTAACAAACGGCTACAGAACTCGAGTTCTGTAGCCGTTTGTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010697.1-916s1c1
Sequence:CCGGCACGCTACTTCCGAAGCATTTCTCGAGAAATGCTTCGGAAGTAGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010697.1-1733s1c1
Sequence:CCGGCCAAGAGAGCAAATCGGAGAACTCGAGTTCTCCGATTTGCTCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-916s21c1
Sequence:CCGGCACGCTACTTCCGAAGCATTTCTCGAGAAATGCTTCGGAAGTAGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-1106s21c1
Sequence:CCGGTGACGACATGATGCGGATAAACTCGAGTTTATCCGCATCATGTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-1831s21c1
Sequence:CCGGGGGAGCAGAAGACGGAATAAACTCGAGTTTATTCCGTCTTCTGCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-1042s21c1
Sequence:CCGGAGCACGGCAAACCCATGTTTACTCGAGTAAACATGGGTTTGCCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-730s21c1
Sequence:CCGGATGGTAACCAAACCGACTATACTCGAGTATAGTCGGTTTGGTTACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010697
VALIDATED
LDB1 MISSION shRNA Lentiviral Transduction Particles
LIM domain binding 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010697.1-1830s1c1
Sequence:CCGGAGGGAGCAGAAGACGGAATAACTCGAGTTATTCCGTCTTCTGCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010697.1-720s1c1
Sequence:CCGGCACACACCATATGGTAACCAACTCGAGTTGGTTACCATATGGTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010697.1-761s1c1
Sequence:CCGGGCTTAACAAACGGCTACAGAACTCGAGTTCTGTAGCCGTTTGTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010697.1-916s1c1
Sequence:CCGGCACGCTACTTCCGAAGCATTTCTCGAGAAATGCTTCGGAAGTAGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010697.1-1733s1c1
Sequence:CCGGCCAAGAGAGCAAATCGGAGAACTCGAGTTCTCCGATTTGCTCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-916s21c1
Sequence:CCGGCACGCTACTTCCGAAGCATTTCTCGAGAAATGCTTCGGAAGTAGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-1106s21c1
Sequence:CCGGTGACGACATGATGCGGATAAACTCGAGTTTATCCGCATCATGTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-1831s21c1
Sequence:CCGGGGGAGCAGAAGACGGAATAAACTCGAGTTTATTCCGTCTTCTGCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-1042s21c1
Sequence:CCGGAGCACGGCAAACCCATGTTTACTCGAGTAAACATGGGTTTGCCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010697.1-730s21c1
Sequence:CCGGATGGTAACCAAACCGACTATACTCGAGTATAGTCGGTTTGGTTACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)