EMAIL THIS PAGE TO A FRIEND

LDB2

LIM domain binding 2

145 Gene Product Result for
Synonyms: CLIM1 LDB1
UniProtKB ID: O43679, O60619, O75480
Gene ID:
Human(9079) Summary: Genes encoding LIM domain-binding factors were initially isolated in a screen for proteins that physically interact with the LIM domains of nuclear proteins (summarized by Semina et al., 1998 [PubMed 9799849]
Mouse(16826) LIM domain binding 2
Rat(289664) LIM domain binding 2
chicken(395631) LIM domain binding 2
dog(479084) LIM domain binding 2
Horse(100055850) LIM domain binding 2
cow(617976) LIM domain binding 2
domestic cat(101094670) LIM domain binding 2
domestic guinea pig(100716618) LIM domain binding 2
naked mole-rat(101714723) LIM domain binding 2
sheep(101107704) LIM domain binding 2
Domestic Rabbit(100355354) LIM domain binding 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066461 MISSION® esiRNA esiRNA human LDB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001290 Rosetta Predictions human pricing
NM_001106009 Rosetta Predictions rat pricing
NM_001077398 Rosetta Predictions mouse pricing
NM_010698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151025 predicted 1130
2 SASI_Hs01_00151026 predicted 398
3 SASI_Hs02_00331551 predicted 645
4 SASI_Hs01_00151027 predicted 686
5 SASI_Hs01_00151028 predicted 1161
6 SASI_Hs01_00151029 predicted 1163
7 SASI_Hs01_00151030 predicted 654
8 SASI_Hs01_00151032 predicted 535
9 SASI_Hs01_00151034 predicted 1192
10 SASI_Hs02_00331552 predicted 608
11 SASI_Hs01_00151031 predicted 482
12 SASI_Hs01_00151033 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214732 predicted 1467
2 SASI_Rn02_00214733 predicted 400
3 SASI_Rn02_00214734 predicted 404
4 SASI_Rn02_00214735 predicted 1464
5 SASI_Rn02_00214736 predicted 1175
6 SASI_Rn02_00214737 predicted 691
7 SASI_Rn02_00214738 predicted 666
8 SASI_Rn02_00214739 predicted 649
9 SASI_Rn02_00214740 predicted 1166
10 SASI_Rn02_00214741 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292572 predicted 426
2 SASI_Mm02_00292573 predicted 528
3 SASI_Mm02_00292574 predicted 506
4 SASI_Mm02_00292575 predicted 1607
5 SASI_Mm02_00292576 predicted 324
6 SASI_Mm02_00292577 predicted 333
7 SASI_Mm02_00292578 predicted 505
8 SASI_Mm02_00292579 predicted 519
9 SASI_Mm02_00292580 predicted 794
10 SASI_Mm02_00292581 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099528 predicted 683
2 SASI_Mm02_00319147 predicted 514
3 SASI_Mm02_00319148 predicted 855
4 SASI_Mm02_00319149 predicted 533
5 SASI_Mm01_00099530 predicted 806
6 SASI_Mm01_00099531 predicted 608
7 SASI_Mm01_00099532 predicted 535
8 SASI_Mm01_00099533 predicted 1380
9 SASI_Mm01_00099534 predicted 549
10 SASI_Mm02_00319150 predicted 641
11 SASI_Mm01_00099525 predicted 1060
12 SASI_Mm01_00099526 predicted 1097
13 SASI_Mm01_00099527 predicted 1153
14 SASI_Mm01_00099529 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001290
LDB2 MISSION shRNA Bacterial Glycerol Stock
LIM domain binding 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001290.3-1472s21c1
Sequence:CCGGCCGTGGGTGATCATTACAATTCTCGAGAATTGTAATGATCACCCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001290.3-1763s21c1
Sequence:CCGGCATCAAACGAAGGCCATATTGCTCGAGCAATATGGCCTTCGTTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001290.3-699s21c1
Sequence:CCGGAGCACGGGAAGCCCATGTTTACTCGAGTAAACATGGGCTTCCCGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001290.3-958s21c1
Sequence:CCGGGGAACTGATGTCGAGACATAACTCGAGTTATGTCTCGACATCAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-295s1c1
Sequence:CCGGCGCCACATTAACCCTTTCATTCTCGAGAATGAAAGGGTTAATGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-1057s1c1
Sequence:CCGGCGAAAGGCTAATCACTAGATTCTCGAGAATCTAGTGATTAGCCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-199s1c1
Sequence:CCGGCCGAATCTATGAGATGAACAACTCGAGTTGTTCATCTCATAGATTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-1179s1c1
Sequence:CCGGCCGCCACTCAAGAGACCAAATCTCGAGATTTGGTCTCTTGAGTGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-367s1c1
Sequence:CCGGCCGTTACTTTAGCACTGTGTTCTCGAGAACACAGTGCTAAAGTAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001290
LDB2 MISSION shRNA shRNA Plasmid DNA
LIM domain binding 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001290.3-1472s21c1
Sequence:CCGGCCGTGGGTGATCATTACAATTCTCGAGAATTGTAATGATCACCCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001290.3-1763s21c1
Sequence:CCGGCATCAAACGAAGGCCATATTGCTCGAGCAATATGGCCTTCGTTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001290.3-699s21c1
Sequence:CCGGAGCACGGGAAGCCCATGTTTACTCGAGTAAACATGGGCTTCCCGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001290.3-958s21c1
Sequence:CCGGGGAACTGATGTCGAGACATAACTCGAGTTATGTCTCGACATCAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-295s1c1
Sequence:CCGGCGCCACATTAACCCTTTCATTCTCGAGAATGAAAGGGTTAATGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-1057s1c1
Sequence:CCGGCGAAAGGCTAATCACTAGATTCTCGAGAATCTAGTGATTAGCCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-199s1c1
Sequence:CCGGCCGAATCTATGAGATGAACAACTCGAGTTGTTCATCTCATAGATTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-1179s1c1
Sequence:CCGGCCGCCACTCAAGAGACCAAATCTCGAGATTTGGTCTCTTGAGTGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-367s1c1
Sequence:CCGGCCGTTACTTTAGCACTGTGTTCTCGAGAACACAGTGCTAAAGTAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001290
LDB2 MISSION shRNA Lentiviral Transduction Particles
LIM domain binding 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001290.3-1472s21c1
Sequence:CCGGCCGTGGGTGATCATTACAATTCTCGAGAATTGTAATGATCACCCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001290.3-1763s21c1
Sequence:CCGGCATCAAACGAAGGCCATATTGCTCGAGCAATATGGCCTTCGTTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001290.3-699s21c1
Sequence:CCGGAGCACGGGAAGCCCATGTTTACTCGAGTAAACATGGGCTTCCCGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001290.3-958s21c1
Sequence:CCGGGGAACTGATGTCGAGACATAACTCGAGTTATGTCTCGACATCAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-295s1c1
Sequence:CCGGCGCCACATTAACCCTTTCATTCTCGAGAATGAAAGGGTTAATGTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-1057s1c1
Sequence:CCGGCGAAAGGCTAATCACTAGATTCTCGAGAATCTAGTGATTAGCCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-199s1c1
Sequence:CCGGCCGAATCTATGAGATGAACAACTCGAGTTGTTCATCTCATAGATTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-1179s1c1
Sequence:CCGGCCGCCACTCAAGAGACCAAATCTCGAGATTTGGTCTCTTGAGTGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001290.1-367s1c1
Sequence:CCGGCCGTTACTTTAGCACTGTGTTCTCGAGAACACAGTGCTAAAGTAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010698
LDB2 MISSION shRNA Bacterial Glycerol Stock
LIM domain binding 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-661s21c1
Sequence:CCGGTGATGACCTCATGAGAATAAACTCGAGTTTATTCTCATGAGGTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010698.3-2097s21c1
Sequence:CCGGCTTGCCATGGGTCCGAATATTCTCGAGAATATTCGGACCCATGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-1002s21c1
Sequence:CCGGCCACAAGCAGCACGTCCAATACTCGAGTATTGGACGTGCTGCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-509s21c1
Sequence:CCGGGACCTGTACTACATCCTTAAACTCGAGTTTAAGGATGTAGTACAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-294s21c1
Sequence:CCGGAGCCAGAGTACCGAATCTATGCTCGAGCATAGATTCGGTACTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-616s1c1
Sequence:CCGGGCACTTTACCATTAGACAGTACTCGAGTACTGTCTAATGGTAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-1091s1c1
Sequence:CCGGGAAAGGCTAATCACTAGATTACTCGAGTAATCTAGTGATTAGCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010698.2-1317s1c1
Sequence:CCGGCCATTCGCAAATCTCTACTATCTCGAGATAGTAGAGATTTGCGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-329s1c1
Sequence:CCGGGCCACATTAACACTTTCATTTCTCGAGAAATGAAAGTGTTAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-361s1c1
Sequence:CCGGCGGACCAAAGCGATACACTATCTCGAGATAGTGTATCGCTTTGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010698
LDB2 MISSION shRNA shRNA Plasmid DNA
LIM domain binding 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-661s21c1
Sequence:CCGGTGATGACCTCATGAGAATAAACTCGAGTTTATTCTCATGAGGTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010698.3-2097s21c1
Sequence:CCGGCTTGCCATGGGTCCGAATATTCTCGAGAATATTCGGACCCATGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-1002s21c1
Sequence:CCGGCCACAAGCAGCACGTCCAATACTCGAGTATTGGACGTGCTGCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-509s21c1
Sequence:CCGGGACCTGTACTACATCCTTAAACTCGAGTTTAAGGATGTAGTACAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-294s21c1
Sequence:CCGGAGCCAGAGTACCGAATCTATGCTCGAGCATAGATTCGGTACTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-616s1c1
Sequence:CCGGGCACTTTACCATTAGACAGTACTCGAGTACTGTCTAATGGTAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-1091s1c1
Sequence:CCGGGAAAGGCTAATCACTAGATTACTCGAGTAATCTAGTGATTAGCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010698.2-1317s1c1
Sequence:CCGGCCATTCGCAAATCTCTACTATCTCGAGATAGTAGAGATTTGCGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-329s1c1
Sequence:CCGGGCCACATTAACACTTTCATTTCTCGAGAAATGAAAGTGTTAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-361s1c1
Sequence:CCGGCGGACCAAAGCGATACACTATCTCGAGATAGTGTATCGCTTTGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010698
LDB2 MISSION shRNA Lentiviral Transduction Particles
LIM domain binding 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-661s21c1
Sequence:CCGGTGATGACCTCATGAGAATAAACTCGAGTTTATTCTCATGAGGTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010698.3-2097s21c1
Sequence:CCGGCTTGCCATGGGTCCGAATATTCTCGAGAATATTCGGACCCATGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-1002s21c1
Sequence:CCGGCCACAAGCAGCACGTCCAATACTCGAGTATTGGACGTGCTGCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-509s21c1
Sequence:CCGGGACCTGTACTACATCCTTAAACTCGAGTTTAAGGATGTAGTACAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010698.3-294s21c1
Sequence:CCGGAGCCAGAGTACCGAATCTATGCTCGAGCATAGATTCGGTACTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-616s1c1
Sequence:CCGGGCACTTTACCATTAGACAGTACTCGAGTACTGTCTAATGGTAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-1091s1c1
Sequence:CCGGGAAAGGCTAATCACTAGATTACTCGAGTAATCTAGTGATTAGCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010698.2-1317s1c1
Sequence:CCGGCCATTCGCAAATCTCTACTATCTCGAGATAGTAGAGATTTGCGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-329s1c1
Sequence:CCGGGCCACATTAACACTTTCATTTCTCGAGAAATGAAAGTGTTAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010698.2-361s1c1
Sequence:CCGGCGGACCAAAGCGATACACTATCTCGAGATAGTGTATCGCTTTGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)