EMAIL THIS PAGE TO A FRIEND

LDB3

LIM domain binding 3

309 Gene Product Result for
Synonyms: CMD1C CYPHER LDB3Z1 LDB3Z4 LVNC3 MFM4 ORACLE PDLIM6 ZASP
Gene ID:
Human(11155) Summary: This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]
Mouse(24131) LIM domain binding 3
Rat(498587) LIM domain binding 3
chicken(423610) LIM domain binding 3
cow(536781) LIM domain binding 3
dog(479269) LIM domain binding 3
sheep(101111515) LIM domain binding 3
Domestic Rabbit(100348927) LIM domain binding 3
domestic guinea pig(100724737) LIM domain binding 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007078 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082001 MISSION® esiRNA esiRNA human LDB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080114 Rosetta Predictions human pricing
NM_001080115 Rosetta Predictions human pricing
NM_001080116 Rosetta Predictions human pricing
NM_007078 Rosetta Predictions human pricing
NM_001110490 Rosetta Predictions rat pricing
NM_001039071 Rosetta Predictions mouse pricing
NM_001039072 Rosetta Predictions mouse pricing
NM_001039073 Rosetta Predictions mouse pricing
NM_001039074 Rosetta Predictions mouse pricing
NM_001039075 Rosetta Predictions mouse pricing
NM_001039076 Rosetta Predictions mouse pricing
NM_011918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314161 predicted 2156
2 SASI_Hs02_00314162 predicted 2240
3 SASI_Hs02_00314163 predicted 2179
4 SASI_Hs02_00314164 predicted 2169
5 SASI_Hs02_00314165 predicted 2239
6 SASI_Hs02_00314166 predicted 2086
7 SASI_Hs02_00314167 predicted 2081
8 SASI_Hs02_00314168 predicted 2338
9 SASI_Hs02_00314169 predicted 1408
10 SASI_Hs02_00314170 predicted 2219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314171 predicted 913
2 SASI_Hs02_00314172 predicted 1091
3 SASI_Hs02_00314173 predicted 1287
4 SASI_Hs02_00314174 predicted 1292
5 SASI_Hs02_00314175 predicted 977
6 SASI_Hs02_00314176 predicted 1098
7 SASI_Hs02_00314177 predicted 912
8 SASI_Hs02_00314178 predicted 916
9 SASI_Hs02_00314179 predicted 1097
10 SASI_Hs02_00314180 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314181 predicted 873
2 SASI_Hs02_00314182 predicted 1060
3 SASI_Hs02_00314183 predicted 1252
4 SASI_Hs02_00314184 predicted 1251
5 SASI_Hs02_00314185 predicted 941
6 SASI_Hs02_00314186 predicted 1055
7 SASI_Hs02_00314187 predicted 876
8 SASI_Hs02_00314188 predicted 880
9 SASI_Hs02_00314189 predicted 1068
10 SASI_Hs02_00314190 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046398 predicted 2484
2 SASI_Hs01_00046400 predicted 2576
3 SASI_Hs01_00046402 predicted 2510
4 SASI_Hs01_00046403 predicted 2493
5 SASI_Hs02_00342904 predicted 2572
6 SASI_Hs02_00342905 predicted 2415
7 SASI_Hs01_00046405 predicted 2412
8 SASI_Hs01_00046406 predicted 2669
9 SASI_Hs02_00342906 predicted 1740
10 SASI_Hs02_00342907 predicted 2548
11 SASI_Hs01_00046399 predicted 765
12 SASI_Hs01_00046401 predicted 2364
13 SASI_Hs01_00046404 predicted 2437
14 SASI_Hs01_00046407 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251252 predicted 851
2 SASI_Rn02_00251253 predicted 786
3 SASI_Rn02_00251254 predicted 1126
4 SASI_Rn02_00251255 predicted 916
5 SASI_Rn02_00251256 predicted 687
6 SASI_Rn02_00251257 predicted 1135
7 SASI_Rn02_00251258 predicted 794
8 SASI_Rn02_00251259 predicted 1138
9 SASI_Rn02_00251260 predicted 1031
10 SASI_Rn02_00251261 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034416 predicted 1419
2 SASI_Mm01_00034417 predicted 1550
3 SASI_Mm01_00034418 predicted 1692
4 SASI_Mm01_00034419 predicted 2093
5 SASI_Mm01_00034420 predicted 2064
6 SASI_Mm01_00034421 predicted 1734
7 SASI_Mm01_00034422 predicted 1914
8 SASI_Mm01_00034423 predicted 1929
9 SASI_Mm01_00034424 predicted 1475
10 SASI_Mm01_00034425 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047470 predicted 1474
2 SASI_Mm01_00047471 predicted 1605
3 SASI_Mm01_00047472 predicted 1744
4 SASI_Mm01_00047473 predicted 2146
5 SASI_Mm01_00047474 predicted 2122
6 SASI_Mm01_00047475 predicted 1787
7 SASI_Mm01_00047476 predicted 1961
8 SASI_Mm01_00047477 predicted 1986
9 SASI_Mm01_00047478 predicted 1521
10 SASI_Mm01_00047479 predicted 1760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096778 predicted 1302
2 SASI_Mm01_00096779 predicted 1436
3 SASI_Mm01_00096780 predicted 1570
4 SASI_Mm01_00096781 predicted 1972
5 SASI_Mm01_00096782 predicted 1951
6 SASI_Mm01_00096783 predicted 1618
7 SASI_Mm01_00096784 predicted 1790
8 SASI_Mm01_00096785 predicted 1815
9 SASI_Mm01_00096786 predicted 1356
10 SASI_Mm01_00096787 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106368 predicted 1518
2 SASI_Mm01_00106369 predicted 1649
3 SASI_Mm01_00106370 predicted 1787
4 SASI_Mm01_00106371 predicted 2196
5 SASI_Mm01_00106372 predicted 2168
6 SASI_Mm01_00106373 predicted 1837
7 SASI_Mm01_00106374 predicted 2009
8 SASI_Mm01_00106375 predicted 2031
9 SASI_Mm01_00106376 predicted 1567
10 SASI_Mm01_00106377 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145951 predicted 873
2 SASI_Mm01_00145952 predicted 936
3 SASI_Mm02_00289752 predicted 1051
4 SASI_Mm01_00145953 predicted 873
5 SASI_Mm01_00145955 predicted 1042
6 SASI_Mm01_00145957 predicted 1184
7 SASI_Mm02_00289753 predicted 1131
8 SASI_Mm02_00289754 predicted 1279
9 SASI_Mm01_00145959 predicted 890
10 SASI_Mm02_00289755 predicted 1273
11 SASI_Mm01_00145954 predicted 936
12 SASI_Mm01_00145956 predicted 881
13 SASI_Mm01_00145958 predicted 1175
14 SASI_Mm01_00145960 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155283 predicted 990
2 SASI_Mm01_00155284 predicted 1054
3 SASI_Mm02_00289756 predicted 1165
4 SASI_Mm01_00155285 predicted 990
5 SASI_Mm01_00155287 predicted 1159
6 SASI_Mm01_00155289 predicted 1305
7 SASI_Mm02_00289757 predicted 1254
8 SASI_Mm02_00289758 predicted 1391
9 SASI_Mm01_00155291 predicted 1002
10 SASI_Mm02_00289759 predicted 1394
11 SASI_Mm01_00155286 predicted 1056
12 SASI_Mm01_00155288 predicted 996
13 SASI_Mm01_00155290 predicted 1295
14 SASI_Mm01_00155292 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058198 predicted 1608
2 SASI_Mm01_00058199 predicted 1739
3 SASI_Mm01_00058200 predicted 1876
4 SASI_Mm01_00058201 predicted 2278
5 SASI_Mm01_00058202 predicted 2251
6 SASI_Mm01_00058203 predicted 1915
7 SASI_Mm01_00058204 predicted 2101
8 SASI_Mm01_00058205 predicted 2110
9 SASI_Mm01_00058206 predicted 1660
10 SASI_Mm01_00058207 predicted 1889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011918
LDB3 MISSION shRNA Bacterial Glycerol Stock
LIM domain binding 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011918.4-2640s21c1
Sequence:CCGGGGCAGTTATGGAGGATCTAAACTCGAGTTTAGATCCTCCATAACTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-1859s1c1
Sequence:CCGGCGGTGTTACGAGCAGTTCTTTCTCGAGAAAGAACTGCTCGTAACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-910s1c1
Sequence:CCGGCGGGACAGAATACATGCAAGACTCGAGTCTTGCATGTATTCTGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011918.2-2280s1c1
Sequence:CCGGGCTCCTGCTACTGATGACGAACTCGAGTTCGTCATCAGTAGCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-304s1c1
Sequence:CCGGCCTCACTCTACAGAAGTCCAACTCGAGTTGGACTTCTGTAGAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-1882s1c1
Sequence:CCGGCCCGATCTGTGCCAAATGTAACTCGAGTTACATTTGGCACAGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011918.4-2211s21c1
Sequence:CCGGGGTCAGCCATTCTACTCTAAGCTCGAGCTTAGAGTAGAATGGCTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011918
LDB3 MISSION shRNA shRNA Plasmid DNA
LIM domain binding 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011918.4-2640s21c1
Sequence:CCGGGGCAGTTATGGAGGATCTAAACTCGAGTTTAGATCCTCCATAACTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-1859s1c1
Sequence:CCGGCGGTGTTACGAGCAGTTCTTTCTCGAGAAAGAACTGCTCGTAACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-910s1c1
Sequence:CCGGCGGGACAGAATACATGCAAGACTCGAGTCTTGCATGTATTCTGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011918.2-2280s1c1
Sequence:CCGGGCTCCTGCTACTGATGACGAACTCGAGTTCGTCATCAGTAGCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-304s1c1
Sequence:CCGGCCTCACTCTACAGAAGTCCAACTCGAGTTGGACTTCTGTAGAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-1882s1c1
Sequence:CCGGCCCGATCTGTGCCAAATGTAACTCGAGTTACATTTGGCACAGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011918.4-2211s21c1
Sequence:CCGGGGTCAGCCATTCTACTCTAAGCTCGAGCTTAGAGTAGAATGGCTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011918
LDB3 MISSION shRNA Lentiviral Transduction Particles
LIM domain binding 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011918.4-2640s21c1
Sequence:CCGGGGCAGTTATGGAGGATCTAAACTCGAGTTTAGATCCTCCATAACTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-1859s1c1
Sequence:CCGGCGGTGTTACGAGCAGTTCTTTCTCGAGAAAGAACTGCTCGTAACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-910s1c1
Sequence:CCGGCGGGACAGAATACATGCAAGACTCGAGTCTTGCATGTATTCTGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011918.2-2280s1c1
Sequence:CCGGGCTCCTGCTACTGATGACGAACTCGAGTTCGTCATCAGTAGCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-304s1c1
Sequence:CCGGCCTCACTCTACAGAAGTCCAACTCGAGTTGGACTTCTGTAGAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011918.2-1882s1c1
Sequence:CCGGCCCGATCTGTGCCAAATGTAACTCGAGTTACATTTGGCACAGATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011918.4-2211s21c1
Sequence:CCGGGGTCAGCCATTCTACTCTAAGCTCGAGCTTAGAGTAGAATGGCTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007078
LDB3 MISSION shRNA Bacterial Glycerol Stock
LIM domain binding 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007078.1-2606s1c1
Sequence:CCGGGCAAACAAATTGAAGTGCCAACTCGAGTTGGCACTTCAATTTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-590s21c1
Sequence:CCGGGAGCCAGCCGAGGCAATATAACTCGAGTTATATTGCCTCGGCTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-1809s21c1
Sequence:CCGGGTTTACTGTGAGCGATGTTATCTCGAGATAACATCGCTCACAGTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007078.1-2507s1c1
Sequence:CCGGCCAAAGCGATACACTTGCTTTCTCGAGAAAGCAAGTGTATCGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007078.1-1818s1c1
Sequence:CCGGGCGATGTTATGAGCAATTCTTCTCGAGAAGAATTGCTCATAACATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-1672s21c1
Sequence:CCGGTCTGCGGTCACTGCAACAATGCTCGAGCATTGTTGCAGTGACCGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007078.2-3690s21c1
Sequence:CCGGTCTCACTTGAGCACGATATTTCTCGAGAAATATCGTGCTCAAGTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-707s21c1
Sequence:CCGGAGGAGGGAGCCTCCCTATTAACTCGAGTTAATAGGGAGGCTCCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007078
LDB3 MISSION shRNA shRNA Plasmid DNA
LIM domain binding 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007078.1-2606s1c1
Sequence:CCGGGCAAACAAATTGAAGTGCCAACTCGAGTTGGCACTTCAATTTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-590s21c1
Sequence:CCGGGAGCCAGCCGAGGCAATATAACTCGAGTTATATTGCCTCGGCTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-1809s21c1
Sequence:CCGGGTTTACTGTGAGCGATGTTATCTCGAGATAACATCGCTCACAGTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007078.1-2507s1c1
Sequence:CCGGCCAAAGCGATACACTTGCTTTCTCGAGAAAGCAAGTGTATCGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007078.1-1818s1c1
Sequence:CCGGGCGATGTTATGAGCAATTCTTCTCGAGAAGAATTGCTCATAACATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-1672s21c1
Sequence:CCGGTCTGCGGTCACTGCAACAATGCTCGAGCATTGTTGCAGTGACCGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007078.2-3690s21c1
Sequence:CCGGTCTCACTTGAGCACGATATTTCTCGAGAAATATCGTGCTCAAGTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-707s21c1
Sequence:CCGGAGGAGGGAGCCTCCCTATTAACTCGAGTTAATAGGGAGGCTCCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007078
LDB3 MISSION shRNA Lentiviral Transduction Particles
LIM domain binding 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007078.1-2606s1c1
Sequence:CCGGGCAAACAAATTGAAGTGCCAACTCGAGTTGGCACTTCAATTTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-590s21c1
Sequence:CCGGGAGCCAGCCGAGGCAATATAACTCGAGTTATATTGCCTCGGCTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-1809s21c1
Sequence:CCGGGTTTACTGTGAGCGATGTTATCTCGAGATAACATCGCTCACAGTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007078.1-2507s1c1
Sequence:CCGGCCAAAGCGATACACTTGCTTTCTCGAGAAAGCAAGTGTATCGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007078.1-1818s1c1
Sequence:CCGGGCGATGTTATGAGCAATTCTTCTCGAGAAGAATTGCTCATAACATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-1672s21c1
Sequence:CCGGTCTGCGGTCACTGCAACAATGCTCGAGCATTGTTGCAGTGACCGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007078.2-3690s21c1
Sequence:CCGGTCTCACTTGAGCACGATATTTCTCGAGAAATATCGTGCTCAAGTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007078.2-707s21c1
Sequence:CCGGAGGAGGGAGCCTCCCTATTAACTCGAGTTAATAGGGAGGCTCCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)