EMAIL THIS PAGE TO A FRIEND

LDHA

lactate dehydrogenase A

84 Gene Product Result for
Synonyms: GSD11 LDH1 LDHM
Gene ID:
Human(3939) Summary: The protein encoded by this gene catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. The protein is found predominantly in muscle tissue and belongs to the lactate dehydrogenase family. Mutations in this gene have been linked to exertional myoglobinuria. Multiple transcript variants encoding different isoforms have been found for this gene. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Sep 2008]
Mouse(16828) lactate dehydrogenase A
Rat(24533) lactate dehydrogenase A
sheep(443089) lactate dehydrogenase A
Domestic Rabbit(100009107) lactate dehydrogenase A
domestic guinea pig(100713875) lactate dehydrogenase A
naked mole-rat(101715364) lactate dehydrogenase A
Zebrafish(30496) lactate dehydrogenase A4
chicken(396221) lactate dehydrogenase A
cow(281274) lactate dehydrogenase A
Horse(100057016) lactate dehydrogenase A
domestic cat(101100248) lactate dehydrogenase A
dog(476882) lactate dehydrogenase A
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108638 Anti-LDHA affinity isolated antibody mouse, pig, goat, bovine, rabbit, guinea pig, human, horse, rat, canine, human
immunohistochemistry, western blot pricing
SAB1100050 Anti-LDHA (216-228) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406077 Anti-LDHA antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2108169 Anti-LDHA antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, bovine, mouse, rat, pig, human
immunohistochemistry, western blot pricing
AV54777 Anti-LDHA antibody produced in rabbit affinity isolated antibody horse, human, rabbit, zebrafish, rabbit, guinea pig
western blot pricing
SAB4100133 Monoclonal Anti-LDHA antibody produced in mouse clone LDHA-C47, culture supernatant human
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
G8761 (±)-Gossypol from cotton seeds ≥95% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005566 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005566 siRNAs that have been validated in the lab human pricing
NM_017025 Rosetta Predictions rat pricing
NM_010699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005566 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150522 validated 530
2 SASI_Hs01_00150525 predicted 1046
3 SASI_Hs02_00339830 predicted 866
4 SASI_Hs02_00339831 predicted 1059
5 SASI_Hs02_00339832 predicted 1224
6 SASI_Hs01_00150524 predicted 717
7 SASI_Hs02_00339833 predicted 1040
8 SASI_Hs01_00150526 predicted 862
9 SASI_Hs02_00339834 predicted 1231
10 SASI_Hs01_00150528 predicted 929
11 SASI_Hs01_00150523 predicted 871
12 SASI_Hs01_00150527 predicted 345
13 SASI_Hs01_00150529 predicted 706
14 SASI_Hs01_00150530 predicted 415
15 SASI_Hs01_00150531 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046924 predicted 449
2 SASI_Rn01_00046925 predicted 255
3 SASI_Rn01_00046926 predicted 420
4 SASI_Rn02_00261199 predicted 433
5 SASI_Rn01_00046928 predicted 275
6 SASI_Rn01_00046930 predicted 822
7 SASI_Rn01_00046932 predicted 916
8 SASI_Rn01_00046933 predicted 445
9 SASI_Rn02_00261200 predicted 434
10 SASI_Rn02_00261201 predicted 569
11 SASI_Rn01_00046927 predicted 1100
12 SASI_Rn01_00046929 predicted 872
13 SASI_Rn01_00046931 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049543 predicted 684
2 SASI_Mm02_00319151 predicted 566
3 SASI_Mm01_00049544 predicted 447
4 SASI_Mm01_00049545 predicted 911
5 SASI_Mm01_00049546 predicted 528
6 SASI_Mm01_00049548 predicted 530
7 SASI_Mm02_00319152 predicted 549
8 SASI_Mm01_00049550 predicted 660
9 SASI_Mm02_00319153 predicted 664
10 SASI_Mm02_00319154 predicted 853
11 SASI_Mm01_00049547 predicted 1018
12 SASI_Mm01_00049549 predicted 963
13 SASI_Mm01_00049551 predicted 1024
14 SASI_Mm01_00049552 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010699
VALIDATED
LDHA MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010699.1-1484s21c1
Sequence:CCGGGTTCCCAGTTAAGTCGTATAACTCGAGTTATACGACTTAACTGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010699.1-434s21c1
Sequence:CCGGCCAGCAAAGACTACTGTGTAACTCGAGTTACACAGTAGTCTTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010699.1-537s21c1
Sequence:CCGGCGTGAACATCTTCAAGTTCATCTCGAGATGAACTTGAAGATGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010699.1-822s21c1
Sequence:CCGGCGTCTCCCTGAAGTCTCTTAACTCGAGTTAAGAGACTTCAGGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-1484s1c1
Sequence:CCGGGTTCCCAGTTAAGTCGTATAACTCGAGTTATACGACTTAACTGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-537s1c1
Sequence:CCGGCGTGAACATCTTCAAGTTCATCTCGAGATGAACTTGAAGATGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-434s1c1
Sequence:CCGGCCAGCAAAGACTACTGTGTAACTCGAGTTACACAGTAGTCTTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-822s1c1
Sequence:CCGGCGTCTCCCTGAAGTCTCTTAACTCGAGTTAAGAGACTTCAGGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-603s1c1
Sequence:CCGGCGTCTCCAATCCAGTGGATATCTCGAGATATCCACTGGATTGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010699
VALIDATED
LDHA MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010699.1-1484s21c1
Sequence:CCGGGTTCCCAGTTAAGTCGTATAACTCGAGTTATACGACTTAACTGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010699.1-434s21c1
Sequence:CCGGCCAGCAAAGACTACTGTGTAACTCGAGTTACACAGTAGTCTTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010699.1-537s21c1
Sequence:CCGGCGTGAACATCTTCAAGTTCATCTCGAGATGAACTTGAAGATGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010699.1-822s21c1
Sequence:CCGGCGTCTCCCTGAAGTCTCTTAACTCGAGTTAAGAGACTTCAGGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-1484s1c1
Sequence:CCGGGTTCCCAGTTAAGTCGTATAACTCGAGTTATACGACTTAACTGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-537s1c1
Sequence:CCGGCGTGAACATCTTCAAGTTCATCTCGAGATGAACTTGAAGATGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-434s1c1
Sequence:CCGGCCAGCAAAGACTACTGTGTAACTCGAGTTACACAGTAGTCTTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-822s1c1
Sequence:CCGGCGTCTCCCTGAAGTCTCTTAACTCGAGTTAAGAGACTTCAGGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-603s1c1
Sequence:CCGGCGTCTCCAATCCAGTGGATATCTCGAGATATCCACTGGATTGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010699
VALIDATED
LDHA MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010699.1-1484s21c1
Sequence:CCGGGTTCCCAGTTAAGTCGTATAACTCGAGTTATACGACTTAACTGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010699.1-434s21c1
Sequence:CCGGCCAGCAAAGACTACTGTGTAACTCGAGTTACACAGTAGTCTTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010699.1-537s21c1
Sequence:CCGGCGTGAACATCTTCAAGTTCATCTCGAGATGAACTTGAAGATGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010699.1-822s21c1
Sequence:CCGGCGTCTCCCTGAAGTCTCTTAACTCGAGTTAAGAGACTTCAGGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-1484s1c1
Sequence:CCGGGTTCCCAGTTAAGTCGTATAACTCGAGTTATACGACTTAACTGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-537s1c1
Sequence:CCGGCGTGAACATCTTCAAGTTCATCTCGAGATGAACTTGAAGATGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-434s1c1
Sequence:CCGGCCAGCAAAGACTACTGTGTAACTCGAGTTACACAGTAGTCTTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-822s1c1
Sequence:CCGGCGTCTCCCTGAAGTCTCTTAACTCGAGTTAAGAGACTTCAGGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010699.1-603s1c1
Sequence:CCGGCGTCTCCAATCCAGTGGATATCTCGAGATATCCACTGGATTGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005566
VALIDATED
LDHA MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase A
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-1040s1c1
Sequence:CCGGCGTTTGAAGAAGAGTGCAGATCTCGAGATCTGCACTCTTCTTCAAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005566.1-482s1c1
Sequence:CCGGCCGAACTGCAAGTTGCTTATTCTCGAGAATAAGCAACTTGCAGTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-918s1c1
Sequence:CCGGCCACCATGATTAAGGGTCTTTCTCGAGAAAGACCCTTAATCATGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-320s1c1
Sequence:CCGGCCAAAGATTGTCTCTGGCAAACTCGAGTTTGCCAGAGACAATCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005566.1-1179s1c1
Sequence:CCGGGATCTGTGATTAAAGCAGTAACTCGAGTTACTGCTTTAATCACAGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-413s1c1
Sequence:CCGGCGTCTTAATTTGGTCCAGCGTCTCGAGACGCTGGACCAAATTAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005566.1-197s1c1
Sequence:CCGGGCCTGTGCCATCAGTATCTTACTCGAGTAAGATACTGATGGCACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-586s1c1
Sequence:CCGGCAATCTGGATTCAGCCCGATTCTCGAGAATCGGGCTGAATCCAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-986s1c1
Sequence:CCGGCAGAATGGAATCTCAGACCTTCTCGAGAAGGTCTGAGATTCCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-940s1c1
Sequence:CCGGCGGAATAAAGGATGATGTCTTCTCGAGAAGACATCATCCTTTATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005566.1-208s1c1
Sequence:CCGGCAGTATCTTAATGAAGGACTTCTCGAGAAGTCCTTCATTAAGATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005566.1-489s1c1
Sequence:CCGGGCAAGTTGCTTATTGTTTCAACTCGAGTTGAAACAATAAGCAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-430s1c1
Sequence:CCGGGCGTAACGTGAACATATTTAACTCGAGTTAAATATGTTCACGTTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-635s1c1
Sequence:CCGGGTTCACCCATTAAGCTGTCATCTCGAGATGACAGCTTAATGGGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005566.1-1479s1c1
Sequence:CCGGCCTGGGATCCAGTGTATAAATCTCGAGATTTATACACTGGATCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-740s1c1
Sequence:CCGGCACCCAGATTTAGGGACTGATCTCGAGATCAGTCCCTAAATCTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005566.1-356s1c1
Sequence:CCGGGCAAACTCCAAGCTGGTCATTCTCGAGAATGACCAGCTTGGAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005566
VALIDATED
LDHA MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase A
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-1040s1c1
Sequence:CCGGCGTTTGAAGAAGAGTGCAGATCTCGAGATCTGCACTCTTCTTCAAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005566.1-482s1c1
Sequence:CCGGCCGAACTGCAAGTTGCTTATTCTCGAGAATAAGCAACTTGCAGTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-918s1c1
Sequence:CCGGCCACCATGATTAAGGGTCTTTCTCGAGAAAGACCCTTAATCATGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-320s1c1
Sequence:CCGGCCAAAGATTGTCTCTGGCAAACTCGAGTTTGCCAGAGACAATCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005566.1-1179s1c1
Sequence:CCGGGATCTGTGATTAAAGCAGTAACTCGAGTTACTGCTTTAATCACAGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-413s1c1
Sequence:CCGGCGTCTTAATTTGGTCCAGCGTCTCGAGACGCTGGACCAAATTAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005566.1-197s1c1
Sequence:CCGGGCCTGTGCCATCAGTATCTTACTCGAGTAAGATACTGATGGCACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-586s1c1
Sequence:CCGGCAATCTGGATTCAGCCCGATTCTCGAGAATCGGGCTGAATCCAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-986s1c1
Sequence:CCGGCAGAATGGAATCTCAGACCTTCTCGAGAAGGTCTGAGATTCCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-940s1c1
Sequence:CCGGCGGAATAAAGGATGATGTCTTCTCGAGAAGACATCATCCTTTATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005566.1-208s1c1
Sequence:CCGGCAGTATCTTAATGAAGGACTTCTCGAGAAGTCCTTCATTAAGATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005566.1-489s1c1
Sequence:CCGGGCAAGTTGCTTATTGTTTCAACTCGAGTTGAAACAATAAGCAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-430s1c1
Sequence:CCGGGCGTAACGTGAACATATTTAACTCGAGTTAAATATGTTCACGTTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-635s1c1
Sequence:CCGGGTTCACCCATTAAGCTGTCATCTCGAGATGACAGCTTAATGGGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005566.1-1479s1c1
Sequence:CCGGCCTGGGATCCAGTGTATAAATCTCGAGATTTATACACTGGATCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-740s1c1
Sequence:CCGGCACCCAGATTTAGGGACTGATCTCGAGATCAGTCCCTAAATCTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005566.1-356s1c1
Sequence:CCGGGCAAACTCCAAGCTGGTCATTCTCGAGAATGACCAGCTTGGAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005566
VALIDATED
LDHA MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase A
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-1040s1c1
Sequence:CCGGCGTTTGAAGAAGAGTGCAGATCTCGAGATCTGCACTCTTCTTCAAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005566.1-482s1c1
Sequence:CCGGCCGAACTGCAAGTTGCTTATTCTCGAGAATAAGCAACTTGCAGTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-918s1c1
Sequence:CCGGCCACCATGATTAAGGGTCTTTCTCGAGAAAGACCCTTAATCATGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-320s1c1
Sequence:CCGGCCAAAGATTGTCTCTGGCAAACTCGAGTTTGCCAGAGACAATCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005566.1-1179s1c1
Sequence:CCGGGATCTGTGATTAAAGCAGTAACTCGAGTTACTGCTTTAATCACAGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-413s1c1
Sequence:CCGGCGTCTTAATTTGGTCCAGCGTCTCGAGACGCTGGACCAAATTAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005566.1-197s1c1
Sequence:CCGGGCCTGTGCCATCAGTATCTTACTCGAGTAAGATACTGATGGCACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-586s1c1
Sequence:CCGGCAATCTGGATTCAGCCCGATTCTCGAGAATCGGGCTGAATCCAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-986s1c1
Sequence:CCGGCAGAATGGAATCTCAGACCTTCTCGAGAAGGTCTGAGATTCCATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-940s1c1
Sequence:CCGGCGGAATAAAGGATGATGTCTTCTCGAGAAGACATCATCCTTTATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005566.1-208s1c1
Sequence:CCGGCAGTATCTTAATGAAGGACTTCTCGAGAAGTCCTTCATTAAGATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005566.1-489s1c1
Sequence:CCGGGCAAGTTGCTTATTGTTTCAACTCGAGTTGAAACAATAAGCAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005566.1-430s1c1
Sequence:CCGGGCGTAACGTGAACATATTTAACTCGAGTTAAATATGTTCACGTTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-635s1c1
Sequence:CCGGGTTCACCCATTAAGCTGTCATCTCGAGATGACAGCTTAATGGGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005566.1-1479s1c1
Sequence:CCGGCCTGGGATCCAGTGTATAAATCTCGAGATTTATACACTGGATCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005566.1-740s1c1
Sequence:CCGGCACCCAGATTTAGGGACTGATCTCGAGATCAGTCCCTAAATCTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005566.1-356s1c1
Sequence:CCGGGCAAACTCCAAGCTGGTCATTCTCGAGAATGACCAGCTTGGAGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)