EMAIL THIS PAGE TO A FRIEND

LDHAL6A

lactate dehydrogenase A-like 6A

20 Gene Product Result for
Synonyms: LDH6A
Species: Human LDHAL6A(160287), domestic cat LDHAL6A(101096600)
UniProtKB ID: Q6ZMR3, D3DQY5
Gene ID:
domestic cat(101096600) lactate dehydrogenase A-like 6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144972 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006041 MISSION® esiRNA esiRNA targeting human LDHAL6A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144972 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077578 predicted 1095
2 SASI_Hs01_00077579 predicted 1167
3 SASI_Hs01_00077580 predicted 1683
4 SASI_Hs01_00077581 predicted 1163
5 SASI_Hs01_00077582 predicted 798
6 SASI_Hs01_00077583 predicted 1125
7 SASI_Hs01_00077584 predicted 1039
8 SASI_Hs01_00077585 predicted 920
9 SASI_Hs01_00077586 predicted 1187
10 SASI_Hs02_00364763 predicted 1014
11 SASI_Hs01_00077587 predicted 1146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144972
LDHAL6A MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase A-like 6A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144972.4-1881s21c1
Sequence:CCGGGAAGATGAAATAGTAGTTATGCTCGAGCATAACTACTATTTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144972.4-1082s21c1
Sequence:CCGGTATTGTCTCCAGCAAAGATTACTCGAGTAATCTTTGCTGGAGACAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-598s1c1
Sequence:CCGGGCGAAATGTATCCATCTTTAACTCGAGTTAAAGATGGATACATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-309s1c1
Sequence:CCGGAGGAGGCCATTCATCACAATACTCGAGTATTGTGATGAATGGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-896s1c1
Sequence:CCGGCTGAAGGATCTGAACCCAGATCTCGAGATCTGGGTTCAGATCCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-704s1c1
Sequence:CCGGGCCTGGAAGTTGAGTGGATTTCTCGAGAAATCCACTCAACTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-320s1c1
Sequence:CCGGCATCACAATAAGATCTCCATTCTCGAGAATGGAGATCTTATTGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144972.4-1678s21c1
Sequence:CCGGCCCTAAGTAAGGGCCTCTATGCTCGAGCATAGAGGCCCTTACTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144972.4-1958s21c1
Sequence:CCGGGAGGAAAGAGTGACCTATTTACTCGAGTAAATAGGTCACTCTTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144972
LDHAL6A MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase A-like 6A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144972.4-1881s21c1
Sequence:CCGGGAAGATGAAATAGTAGTTATGCTCGAGCATAACTACTATTTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144972.4-1082s21c1
Sequence:CCGGTATTGTCTCCAGCAAAGATTACTCGAGTAATCTTTGCTGGAGACAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-598s1c1
Sequence:CCGGGCGAAATGTATCCATCTTTAACTCGAGTTAAAGATGGATACATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-309s1c1
Sequence:CCGGAGGAGGCCATTCATCACAATACTCGAGTATTGTGATGAATGGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-896s1c1
Sequence:CCGGCTGAAGGATCTGAACCCAGATCTCGAGATCTGGGTTCAGATCCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-704s1c1
Sequence:CCGGGCCTGGAAGTTGAGTGGATTTCTCGAGAAATCCACTCAACTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-320s1c1
Sequence:CCGGCATCACAATAAGATCTCCATTCTCGAGAATGGAGATCTTATTGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144972.4-1678s21c1
Sequence:CCGGCCCTAAGTAAGGGCCTCTATGCTCGAGCATAGAGGCCCTTACTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144972.4-1958s21c1
Sequence:CCGGGAGGAAAGAGTGACCTATTTACTCGAGTAAATAGGTCACTCTTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144972
LDHAL6A MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase A-like 6A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144972.4-1881s21c1
Sequence:CCGGGAAGATGAAATAGTAGTTATGCTCGAGCATAACTACTATTTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144972.4-1082s21c1
Sequence:CCGGTATTGTCTCCAGCAAAGATTACTCGAGTAATCTTTGCTGGAGACAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-598s1c1
Sequence:CCGGGCGAAATGTATCCATCTTTAACTCGAGTTAAAGATGGATACATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-309s1c1
Sequence:CCGGAGGAGGCCATTCATCACAATACTCGAGTATTGTGATGAATGGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-896s1c1
Sequence:CCGGCTGAAGGATCTGAACCCAGATCTCGAGATCTGGGTTCAGATCCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-704s1c1
Sequence:CCGGGCCTGGAAGTTGAGTGGATTTCTCGAGAAATCCACTCAACTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144972.1-320s1c1
Sequence:CCGGCATCACAATAAGATCTCCATTCTCGAGAATGGAGATCTTATTGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144972.4-1678s21c1
Sequence:CCGGCCCTAAGTAAGGGCCTCTATGCTCGAGCATAGAGGCCCTTACTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144972.4-1958s21c1
Sequence:CCGGGAGGAAAGAGTGACCTATTTACTCGAGTAAATAGGTCACTCTTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)