EMAIL THIS PAGE TO A FRIEND

LDHAL6B

lactate dehydrogenase A-like 6B

50 Gene Product Result for
Synonyms: LDH6B LDHAL6 LDHL
UniProtKB ID: Q9BYZ2, Q6DUY4, Q96LI2
Gene ID:
Mouse(106557) lactate dehydrogenase A-like 6B
Rat(369018) lactate dehydrogenase A-like 6B
dog(484048) lactate dehydrogenase A-like 6B
cow(509519) lactate dehydrogenase A-like 6B
Domestic Rabbit(100338725) lactate dehydrogenase A-like 6B
domestic guinea pig(100715311) lactate dehydrogenase A-like 6B
naked mole-rat(101703298) lactate dehydrogenase A-like 6B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033195 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110491 MISSION® esiRNA esiRNA human LDHAL6B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033195 Rosetta Predictions human pricing
NM_183334 Rosetta Predictions rat pricing
NM_175349 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155960 predicted 995
2 SASI_Hs01_00155963 predicted 1293
3 SASI_Hs01_00155964 predicted 259
4 SASI_Hs01_00155965 predicted 1208
5 SASI_Hs01_00155966 predicted 1280
6 SASI_Hs01_00155967 predicted 1272
7 SASI_Hs02_00360982 predicted 239
8 SASI_Hs02_00360983 predicted 1062
9 SASI_Hs01_00155961 predicted 1080
10 SASI_Hs01_00155962 predicted 1316
11 SASI_Hs01_00155968 predicted 718
12 SASI_Hs01_00155969 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050758 predicted 584
2 SASI_Rn02_00269888 predicted 1145
3 SASI_Rn01_00050759 predicted 479
4 SASI_Rn01_00050761 predicted 891
5 SASI_Rn01_00050762 predicted 306
6 SASI_Rn01_00050763 predicted 891
7 SASI_Rn01_00050764 predicted 382
8 SASI_Rn01_00050765 predicted 1021
9 SASI_Rn01_00050766 predicted 985
10 SASI_Rn01_00050767 predicted 1025
11 SASI_Rn01_00050760 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073822 predicted 598
2 SASI_Mm01_00073823 predicted 1206
3 SASI_Mm01_00073824 predicted 831
4 SASI_Mm01_00073825 predicted 587
5 SASI_Mm01_00073826 predicted 719
6 SASI_Mm01_00073827 predicted 674
7 SASI_Mm01_00073828 predicted 671
8 SASI_Mm01_00073829 predicted 571
9 SASI_Mm01_00073830 predicted 753
10 SASI_Mm01_00073831 predicted 897
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033195
LDHAL6B MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase A-like 6B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033195.1-1226s21c1
Sequence:CCGGGAATAAGCTTAAGCTTTAAAGCTCGAGCTTTAAAGCTTAAGCTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033195.1-1346s21c1
Sequence:CCGGGGAAAGTAGGTAGAGTGATTTCTCGAGAAATCACTCTACCTACTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-1014s1c1
Sequence:CCGGGCCGATTTAACAGAAAGTATTCTCGAGAATACTTTCTGTTAAATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-467s1c1
Sequence:CCGGGCCAAATATTGTTTGTAGCAACTCGAGTTGCTACAAACAATATTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-1136s1c1
Sequence:CCGGGAACGGTATTACCAACCTTATCTCGAGATAAGGTTGGTAATACCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-588s1c1
Sequence:CCGGGCCATCTTCAAGTTAATGATTCTCGAGAATCATTAACTTGAAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-1003s1c1
Sequence:CCGGGCCTATCTGTGGCCGATTTAACTCGAGTTAAATCGGCCACAGATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033195
LDHAL6B MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase A-like 6B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033195.1-1226s21c1
Sequence:CCGGGAATAAGCTTAAGCTTTAAAGCTCGAGCTTTAAAGCTTAAGCTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033195.1-1346s21c1
Sequence:CCGGGGAAAGTAGGTAGAGTGATTTCTCGAGAAATCACTCTACCTACTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-1014s1c1
Sequence:CCGGGCCGATTTAACAGAAAGTATTCTCGAGAATACTTTCTGTTAAATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-467s1c1
Sequence:CCGGGCCAAATATTGTTTGTAGCAACTCGAGTTGCTACAAACAATATTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-1136s1c1
Sequence:CCGGGAACGGTATTACCAACCTTATCTCGAGATAAGGTTGGTAATACCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-588s1c1
Sequence:CCGGGCCATCTTCAAGTTAATGATTCTCGAGAATCATTAACTTGAAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-1003s1c1
Sequence:CCGGGCCTATCTGTGGCCGATTTAACTCGAGTTAAATCGGCCACAGATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033195
LDHAL6B MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase A-like 6B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033195.1-1226s21c1
Sequence:CCGGGAATAAGCTTAAGCTTTAAAGCTCGAGCTTTAAAGCTTAAGCTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033195.1-1346s21c1
Sequence:CCGGGGAAAGTAGGTAGAGTGATTTCTCGAGAAATCACTCTACCTACTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-1014s1c1
Sequence:CCGGGCCGATTTAACAGAAAGTATTCTCGAGAATACTTTCTGTTAAATCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-467s1c1
Sequence:CCGGGCCAAATATTGTTTGTAGCAACTCGAGTTGCTACAAACAATATTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-1136s1c1
Sequence:CCGGGAACGGTATTACCAACCTTATCTCGAGATAAGGTTGGTAATACCGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-588s1c1
Sequence:CCGGGCCATCTTCAAGTTAATGATTCTCGAGAATCATTAACTTGAAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033195.1-1003s1c1
Sequence:CCGGGCCTATCTGTGGCCGATTTAACTCGAGTTAAATCGGCCACAGATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175349
LDHAL6B MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase A-like 6B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175349.2-579s1c1
Sequence:CCGGCTGAATTTAGTCCAGCGAAACCTCGAGGTTTCGCTGGACTAAATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175349.2-150s1c1
Sequence:CCGGGTGAGTACAACCAGGGTAGATCTCGAGATCTACCCTGGTTGTACTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175349.2-405s1c1
Sequence:CCGGGCCCTTGTTGATAATAATGAACTCGAGTTCATTATTATCAACAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175349.2-1091s1c1
Sequence:CCGGCCAAGGTCTCTACGGAATCAACTCGAGTTGATTCCGTAGAGACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175349.2-1264s1c1
Sequence:CCGGCCCTTCTAAAGATACCGAAGACTCGAGTCTTCGGTATCTTTAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175349.2-266s1c1
Sequence:CCGGGACCGTGAAGGGTGAACTTATCTCGAGATAAGTTCACCCTTCACGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175349
LDHAL6B MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase A-like 6B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175349.2-579s1c1
Sequence:CCGGCTGAATTTAGTCCAGCGAAACCTCGAGGTTTCGCTGGACTAAATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175349.2-150s1c1
Sequence:CCGGGTGAGTACAACCAGGGTAGATCTCGAGATCTACCCTGGTTGTACTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175349.2-405s1c1
Sequence:CCGGGCCCTTGTTGATAATAATGAACTCGAGTTCATTATTATCAACAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175349.2-1091s1c1
Sequence:CCGGCCAAGGTCTCTACGGAATCAACTCGAGTTGATTCCGTAGAGACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175349.2-1264s1c1
Sequence:CCGGCCCTTCTAAAGATACCGAAGACTCGAGTCTTCGGTATCTTTAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175349.2-266s1c1
Sequence:CCGGGACCGTGAAGGGTGAACTTATCTCGAGATAAGTTCACCCTTCACGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175349
LDHAL6B MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase A-like 6B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175349.2-579s1c1
Sequence:CCGGCTGAATTTAGTCCAGCGAAACCTCGAGGTTTCGCTGGACTAAATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175349.2-150s1c1
Sequence:CCGGGTGAGTACAACCAGGGTAGATCTCGAGATCTACCCTGGTTGTACTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175349.2-405s1c1
Sequence:CCGGGCCCTTGTTGATAATAATGAACTCGAGTTCATTATTATCAACAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175349.2-1091s1c1
Sequence:CCGGCCAAGGTCTCTACGGAATCAACTCGAGTTGATTCCGTAGAGACCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175349.2-1264s1c1
Sequence:CCGGCCCTTCTAAAGATACCGAAGACTCGAGTCTTCGGTATCTTTAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175349.2-266s1c1
Sequence:CCGGGACCGTGAAGGGTGAACTTATCTCGAGATAAGTTCACCCTTCACGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)