EMAIL THIS PAGE TO A FRIEND

LDHB

lactate dehydrogenase B

78 Gene Product Result for
Synonyms: LDH-B LDH-H LDHBD TRG-5
UniProtKB ID: P07195
Gene ID:
Human(3945) Summary: This gene encodes an enzyme which catalyzes the reversible conversion of lactate and pyruvate, and NAD and NADH, in the glycolytic pathway. Mutations in this gene are associated with lactate dehydrogenase B deficiency. Pseudogenes have been identified on the X chromosome and on chromosome. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Mar 2010]
Mouse(16832) lactate dehydrogenase B
Rat(24534) lactate dehydrogenase B
chicken(373997) lactate dehydrogenase B
dog(477675) lactate dehydrogenase B
domestic cat(101092373) lactate dehydrogenase B
cow(281275) lactate dehydrogenase B
Horse(100033997) lactate dehydrogenase B
domestic guinea pig(100714853) lactate dehydrogenase B
naked mole-rat(101699088) lactate dehydrogenase B
sheep(101118261) lactate dehydrogenase B
Domestic Rabbit(100009106) lactate dehydrogenase B
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
G8761 (±)-Gossypol from cotton seeds ≥95% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002300 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002300 Rosetta Predictions human pricing
NM_012595 Rosetta Predictions rat pricing
NM_008492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181812 predicted 900
2 SASI_Hs01_00181813 predicted 999
3 SASI_Hs02_00333601 predicted 601
4 SASI_Hs01_00181814 predicted 748
5 SASI_Hs02_00333602 predicted 998
6 SASI_Hs01_00181818 predicted 336
7 SASI_Hs02_00333603 predicted 299
8 SASI_Hs01_00181819 predicted 831
9 SASI_Hs01_00181821 predicted 525
10 SASI_Hs02_00333604 predicted 721
11 SASI_Hs01_00181815 predicted 223
12 SASI_Hs01_00181816 predicted 421
13 SASI_Hs01_00181817 predicted 487
14 SASI_Hs01_00181820 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113691 predicted 343
2 SASI_Rn01_00113692 predicted 446
3 SASI_Rn01_00113693 predicted 684
4 SASI_Rn01_00113694 predicted 364
5 SASI_Rn01_00113695 predicted 497
6 SASI_Rn01_00113696 predicted 791
7 SASI_Rn01_00113697 predicted 781
8 SASI_Rn01_00113698 predicted 520
9 SASI_Rn01_00113699 predicted 355
10 SASI_Rn01_00113700 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314029 predicted 836
2 SASI_Mm02_00314030 predicted 485
3 SASI_Mm02_00314031 predicted 582
4 SASI_Mm02_00314032 predicted 917
5 SASI_Mm02_00314033 predicted 441
6 SASI_Mm02_00314034 predicted 416
7 SASI_Mm02_00314035 predicted 351
8 SASI_Mm02_00314036 predicted 563
9 SASI_Mm02_00314037 predicted 617
10 SASI_Mm02_00314038 predicted 717
11 SASI_Mm01_00067446 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002300
VALIDATED
LDHB MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002300.3-738s1c1
Sequence:CCGGCCAGGAATTGAATCCAGAAATCTCGAGATTTCTGGATTCAATTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002300.3-1010s1c1
Sequence:CCGGGCGTTATCAACCAGAAGCTAACTCGAGTTAGCTTCTGGTTGATAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002300.3-160s1c1
Sequence:CCGGCCAAACAATAAGATCACTGTACTCGAGTACAGTGATCTTATTGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002300.3-576s1c1
Sequence:CCGGCGTGATTGGAAGTGGATGTAACTCGAGTTACATCCACTTCCAATCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002300.3-311s1c1
Sequence:CCGGGCTTATTTCTTCAGACACCTACTCGAGTAGGTGTCTGAAGAAATAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002300.5-307s21c1
Sequence:CCGGGCTTATTTCTTCAGACACCTACTCGAGTAGGTGTCTGAAGAAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002300.5-572s21c1
Sequence:CCGGCGTGATTGGAAGTGGATGTAACTCGAGTTACATCCACTTCCAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002300.5-602s21c1
Sequence:CCGGTGCTAGATTTCGCTACCTTATCTCGAGATAAGGTAGCGAAATCTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002300.5-1006s21c1
Sequence:CCGGGCGTTATCAACCAGAAGCTAACTCGAGTTAGCTTCTGGTTGATAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002300.5-1110s21c1
Sequence:CCGGAGCTCTAGGCTGTAGAAATTTCTCGAGAAATTTCTACAGCCTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002300
VALIDATED
LDHB MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002300.3-738s1c1
Sequence:CCGGCCAGGAATTGAATCCAGAAATCTCGAGATTTCTGGATTCAATTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002300.3-1010s1c1
Sequence:CCGGGCGTTATCAACCAGAAGCTAACTCGAGTTAGCTTCTGGTTGATAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002300.3-160s1c1
Sequence:CCGGCCAAACAATAAGATCACTGTACTCGAGTACAGTGATCTTATTGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002300.3-576s1c1
Sequence:CCGGCGTGATTGGAAGTGGATGTAACTCGAGTTACATCCACTTCCAATCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002300.3-311s1c1
Sequence:CCGGGCTTATTTCTTCAGACACCTACTCGAGTAGGTGTCTGAAGAAATAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002300.5-307s21c1
Sequence:CCGGGCTTATTTCTTCAGACACCTACTCGAGTAGGTGTCTGAAGAAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002300.5-572s21c1
Sequence:CCGGCGTGATTGGAAGTGGATGTAACTCGAGTTACATCCACTTCCAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002300.5-602s21c1
Sequence:CCGGTGCTAGATTTCGCTACCTTATCTCGAGATAAGGTAGCGAAATCTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002300.5-1006s21c1
Sequence:CCGGGCGTTATCAACCAGAAGCTAACTCGAGTTAGCTTCTGGTTGATAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002300.5-1110s21c1
Sequence:CCGGAGCTCTAGGCTGTAGAAATTTCTCGAGAAATTTCTACAGCCTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002300
VALIDATED
LDHB MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002300.3-738s1c1
Sequence:CCGGCCAGGAATTGAATCCAGAAATCTCGAGATTTCTGGATTCAATTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002300.3-1010s1c1
Sequence:CCGGGCGTTATCAACCAGAAGCTAACTCGAGTTAGCTTCTGGTTGATAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002300.3-160s1c1
Sequence:CCGGCCAAACAATAAGATCACTGTACTCGAGTACAGTGATCTTATTGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002300.3-576s1c1
Sequence:CCGGCGTGATTGGAAGTGGATGTAACTCGAGTTACATCCACTTCCAATCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002300.3-311s1c1
Sequence:CCGGGCTTATTTCTTCAGACACCTACTCGAGTAGGTGTCTGAAGAAATAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002300.5-307s21c1
Sequence:CCGGGCTTATTTCTTCAGACACCTACTCGAGTAGGTGTCTGAAGAAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002300.5-572s21c1
Sequence:CCGGCGTGATTGGAAGTGGATGTAACTCGAGTTACATCCACTTCCAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002300.5-602s21c1
Sequence:CCGGTGCTAGATTTCGCTACCTTATCTCGAGATAAGGTAGCGAAATCTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002300.5-1006s21c1
Sequence:CCGGGCGTTATCAACCAGAAGCTAACTCGAGTTAGCTTCTGGTTGATAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002300.5-1110s21c1
Sequence:CCGGAGCTCTAGGCTGTAGAAATTTCTCGAGAAATTTCTACAGCCTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008492
VALIDATED
LDHB MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-1006s1c1
Sequence:CCGGCGTCATCAATCAGAAGCTGAACTCGAGTTCAGCTTCTGATTGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-155s1c1
Sequence:CCGGCCGAACAACAAGATCACTGTACTCGAGTACAGTGATCTTGTTGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008492.2-1165s1c1
Sequence:CCGGCCATGTATGTAGGTCACAGTTCTCGAGAACTGTGACCTACATACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-943s1c1
Sequence:CCGGCGGCATTGAGAATGAAGTCTTCTCGAGAAGACTTCATTCTCAATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-514s1c1
Sequence:CCGGCCCAGTGGATATTCTGACTTACTCGAGTAAGTCAGAATATCCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008492
VALIDATED
LDHB MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-1006s1c1
Sequence:CCGGCGTCATCAATCAGAAGCTGAACTCGAGTTCAGCTTCTGATTGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-155s1c1
Sequence:CCGGCCGAACAACAAGATCACTGTACTCGAGTACAGTGATCTTGTTGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008492.2-1165s1c1
Sequence:CCGGCCATGTATGTAGGTCACAGTTCTCGAGAACTGTGACCTACATACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-943s1c1
Sequence:CCGGCGGCATTGAGAATGAAGTCTTCTCGAGAAGACTTCATTCTCAATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-514s1c1
Sequence:CCGGCCCAGTGGATATTCTGACTTACTCGAGTAAGTCAGAATATCCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008492
VALIDATED
LDHB MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-1006s1c1
Sequence:CCGGCGTCATCAATCAGAAGCTGAACTCGAGTTCAGCTTCTGATTGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-155s1c1
Sequence:CCGGCCGAACAACAAGATCACTGTACTCGAGTACAGTGATCTTGTTGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008492.2-1165s1c1
Sequence:CCGGCCATGTATGTAGGTCACAGTTCTCGAGAACTGTGACCTACATACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-943s1c1
Sequence:CCGGCGGCATTGAGAATGAAGTCTTCTCGAGAAGACTTCATTCTCAATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008492.2-514s1c1
Sequence:CCGGCCCAGTGGATATTCTGACTTACTCGAGTAAGTCAGAATATCCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)