EMAIL THIS PAGE TO A FRIEND

LDHD

lactate dehydrogenase D

106 Gene Product Result for
Synonyms: DLD
UniProtKB ID: Q86WU2, Q8IZK5
Gene ID:
Human(197257) Summary: The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(52815) lactate dehydrogenase D
Rat(307858) lactate dehydrogenase D
domestic guinea pig(100729371) lactate dehydrogenase D
naked mole-rat(101711260) lactate dehydrogenase D
sheep(101115643) lactate dehydrogenase D
Zebrafish(334208) lactate dehydrogenase D
chicken(415689) lactate dehydrogenase D, mitochondrial
dog(610390) lactate dehydrogenase D
domestic cat(101090477) lactate dehydrogenase D
cow(510284) lactate dehydrogenase D
Horse(100055206) lactate dehydrogenase D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_194436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194436 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159111 MISSION® esiRNA esiRNA human LDHD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153486 Rosetta Predictions human pricing
NM_194436 Rosetta Predictions human pricing
NM_001008893 Rosetta Predictions rat pricing
NM_027570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183070 predicted 225
2 SASI_Hs02_00367311 predicted 1343
3 SASI_Hs01_00183072 predicted 1298
4 SASI_Hs02_00367312 predicted 454
5 SASI_Hs01_00183074 predicted 1494
6 SASI_Hs01_00183075 predicted 1569
7 SASI_Hs01_00183076 predicted 977
8 SASI_Hs01_00183077 predicted 339
9 SASI_Hs01_00183078 predicted 1823
10 SASI_Hs01_00183079 predicted 398
11 SASI_Hs01_00183071 predicted 1364
12 SASI_Hs01_00183073 predicted 1813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089529 predicted 230
2 SASI_Hs02_00371503 predicted 1278
3 SASI_Hs01_00089531 predicted 1235
4 SASI_Hs02_00371504 predicted 447
5 SASI_Hs01_00089533 predicted 1424
6 SASI_Hs01_00089534 predicted 1501
7 SASI_Hs01_00089535 predicted 911
8 SASI_Hs01_00089536 predicted 338
9 SASI_Hs01_00089537 predicted 1754
10 SASI_Hs01_00089538 predicted 399
11 SASI_Hs01_00089530 predicted 1297
12 SASI_Hs01_00089532 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083742 predicted 662
2 SASI_Rn01_00083743 predicted 891
3 SASI_Rn01_00083744 predicted 470
4 SASI_Rn01_00083745 predicted 803
5 SASI_Rn01_00083746 predicted 859
6 SASI_Rn01_00083747 predicted 192
7 SASI_Rn01_00083748 predicted 551
8 SASI_Rn02_00199449 predicted 380
9 SASI_Rn01_00083749 predicted 990
10 SASI_Rn01_00083751 predicted 278
11 SASI_Rn01_00083750 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067194 predicted 967
2 SASI_Mm01_00067195 predicted 833
3 SASI_Mm01_00067196 predicted 1911
4 SASI_Mm01_00067197 predicted 1093
5 SASI_Mm01_00067198 predicted 1271
6 SASI_Mm01_00067199 predicted 256
7 SASI_Mm01_00067200 predicted 1153
8 SASI_Mm01_00067202 predicted 349
9 SASI_Mm01_00067203 predicted 546
10 SASI_Mm02_00332402 predicted 767
11 SASI_Mm01_00067201 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027570
LDHD MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-1150s1c1
Sequence:CCGGGTAGAGACCAAGGAGGAGATTCTCGAGAATCTCCTCCTTGGTCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-832s1c1
Sequence:CCGGGCTCGCATTGAGTTCCTAGATCTCGAGATCTAGGAACTCAATGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-424s1c1
Sequence:CCGGGTCACCCGTAAAGCTCTCAATCTCGAGATTGAGAGCTTTACGGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-969s1c1
Sequence:CCGGAGAGGCAATCACTCAGGATAACTCGAGTTATCCTGAGTGATTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-262s1c1
Sequence:CCGGCTGTGCTACAATCAAGGTGTTCTCGAGAACACCTTGATTGTAGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027570
LDHD MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-1150s1c1
Sequence:CCGGGTAGAGACCAAGGAGGAGATTCTCGAGAATCTCCTCCTTGGTCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-832s1c1
Sequence:CCGGGCTCGCATTGAGTTCCTAGATCTCGAGATCTAGGAACTCAATGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-424s1c1
Sequence:CCGGGTCACCCGTAAAGCTCTCAATCTCGAGATTGAGAGCTTTACGGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-969s1c1
Sequence:CCGGAGAGGCAATCACTCAGGATAACTCGAGTTATCCTGAGTGATTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-262s1c1
Sequence:CCGGCTGTGCTACAATCAAGGTGTTCTCGAGAACACCTTGATTGTAGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027570
LDHD MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-1150s1c1
Sequence:CCGGGTAGAGACCAAGGAGGAGATTCTCGAGAATCTCCTCCTTGGTCTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-832s1c1
Sequence:CCGGGCTCGCATTGAGTTCCTAGATCTCGAGATCTAGGAACTCAATGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-424s1c1
Sequence:CCGGGTCACCCGTAAAGCTCTCAATCTCGAGATTGAGAGCTTTACGGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-969s1c1
Sequence:CCGGAGAGGCAATCACTCAGGATAACTCGAGTTATCCTGAGTGATTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027570.3-262s1c1
Sequence:CCGGCTGTGCTACAATCAAGGTGTTCTCGAGAACACCTTGATTGTAGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194436
LDHD MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-908s1c1
Sequence:CCGGCAACAGGTACAGCAAGCTGAACTCGAGTTCAGCTTGCTGTACCTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-1475s1c1
Sequence:CCGGCCTCATGAATCCAGGCAAAGTCTCGAGACTTTGCCTGGATTCATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-1188s1c1
Sequence:CCGGCAGACCAAGGAGGATCTGAATCTCGAGATTCAGATCCTCCTTGGTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-392s1c1
Sequence:CCGGCCTGACGCATATGGACCGAATCTCGAGATTCGGTCCATATGCGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-867s1c1
Sequence:CCGGGCCCGCATTGAGTTCCTGGATCTCGAGATCCAGGAACTCAATGCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194436
LDHD MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-908s1c1
Sequence:CCGGCAACAGGTACAGCAAGCTGAACTCGAGTTCAGCTTGCTGTACCTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-1475s1c1
Sequence:CCGGCCTCATGAATCCAGGCAAAGTCTCGAGACTTTGCCTGGATTCATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-1188s1c1
Sequence:CCGGCAGACCAAGGAGGATCTGAATCTCGAGATTCAGATCCTCCTTGGTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-392s1c1
Sequence:CCGGCCTGACGCATATGGACCGAATCTCGAGATTCGGTCCATATGCGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-867s1c1
Sequence:CCGGGCCCGCATTGAGTTCCTGGATCTCGAGATCCAGGAACTCAATGCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194436
LDHD MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-908s1c1
Sequence:CCGGCAACAGGTACAGCAAGCTGAACTCGAGTTCAGCTTGCTGTACCTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-1475s1c1
Sequence:CCGGCCTCATGAATCCAGGCAAAGTCTCGAGACTTTGCCTGGATTCATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-1188s1c1
Sequence:CCGGCAGACCAAGGAGGATCTGAATCTCGAGATTCAGATCCTCCTTGGTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-392s1c1
Sequence:CCGGCCTGACGCATATGGACCGAATCTCGAGATTCGGTCCATATGCGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194436.1-867s1c1
Sequence:CCGGGCCCGCATTGAGTTCCTGGATCTCGAGATCCAGGAACTCAATGCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)