EMAIL THIS PAGE TO A FRIEND

LDLR

low density lipoprotein receptor

85 Gene Product Result for
Synonyms: FH FHC LDLCQ2
Gene ID:
Human(3949) Summary: The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
Mouse(16835) low density lipoprotein receptor
Rat(300438) low density lipoprotein receptor
Zebrafish(387529) low density lipoprotein receptor
dog(100683160) low density lipoprotein receptor
chicken(395103) low density lipoprotein receptor
domestic cat(101080362) low density lipoprotein receptor
cow(281276) low density lipoprotein receptor
Domestic Rabbit(100009086) low density lipoprotein receptor
domestic guinea pig(100724238) low density lipoprotein receptor
naked mole-rat(101703463) low density lipoprotein receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0707 Human LDLR / Low-density Lipoprotein Receptor ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000527 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000527 Rosetta Predictions human pricing
NM_175762 Rosetta Predictions rat pricing
NM_010700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302732 predicted 1997
2 SASI_Hs01_00158944 predicted 830
3 SASI_Hs02_00302733 predicted 2002
4 SASI_Hs01_00158946 predicted 933
5 SASI_Hs01_00158948 predicted 954
6 SASI_Hs01_00158950 predicted 1158
7 SASI_Hs02_00302734 predicted 937
8 SASI_Hs01_00158952 predicted 280
9 SASI_Hs02_00302735 predicted 2638
10 SASI_Hs02_00302736 predicted 2286
11 SASI_Hs01_00158943 predicted 1740
12 SASI_Hs01_00158945 predicted 1012
13 SASI_Hs01_00158947 predicted 1666
14 SASI_Hs01_00158949 predicted 2639
15 SASI_Hs01_00158951 predicted 2041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121675 predicted 2055
2 SASI_Rn01_00121676 predicted 1839
3 SASI_Rn01_00121678 predicted 2005
4 SASI_Rn01_00121679 predicted 2096
5 SASI_Rn01_00121680 predicted 1980
6 SASI_Rn01_00121681 predicted 1842
7 SASI_Rn01_00121682 predicted 2669
8 SASI_Rn01_00121683 predicted 2422
9 SASI_Rn01_00121684 predicted 991
10 SASI_Rn02_00269518 predicted 1692
11 SASI_Rn01_00121677 predicted 2660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084964 predicted 2130
2 SASI_Mm01_00084965 predicted 1878
3 SASI_Mm01_00084966 predicted 2017
4 SASI_Mm01_00084967 predicted 1904
5 SASI_Mm01_00084968 predicted 2172
6 SASI_Mm01_00084970 predicted 1925
7 SASI_Mm01_00084969 predicted 2647
8 SASI_Mm01_00084971 predicted 552
9 SASI_Mm01_00084973 predicted 1924
10 SASI_Mm02_00319155 predicted 1691
11 SASI_Mm01_00084972 predicted 2458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000527
VALIDATED
LDLR MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-1137s1c1
Sequence:CCGGCCAGCGAAGATGCGAAGATATCTCGAGATATCTTCGCATCTTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-201s1c1
Sequence:CCGGCGGGAAATGCATCTCCTACAACTCGAGTTGTAGGAGATGCATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000527.2-2587s1c1
Sequence:CCGGACAGAGGATGAGGTCCACATTCTCGAGAATGTGGACCTCATCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-1071s1c1
Sequence:CCGGCCACGTCTGCAATGACCTTAACTCGAGTTAAGGTCATTGCAGACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-1927s1c1
Sequence:CCGGGCCGTCTTTGAGGACAAAGTACTCGAGTACTTTGTCCTCAAAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-964s21c1
Sequence:CCGGGATGAAGTTGGCTGCGTTAATCTCGAGATTAACGCAGCCAACTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-2337s21c1
Sequence:CCGGGACATCCACCGTCAGGCTAAACTCGAGTTTAGCCTGACGGTGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-2618s21c1
Sequence:CCGGACATCAACAGCATCAACTTTGCTCGAGCAAAGTTGATGCTGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-1781s21c1
Sequence:CCGGCTCCCGCCAAGATCAAGAAAGCTCGAGCTTTCTTGATCTTGGCGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-237s21c1
Sequence:CCGGGGGCGACAGATGCGAAAGAAACTCGAGTTTCTTTCGCATCTGTCGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-2449s21c1
Sequence:CCGGACGGTGGAGATAGTGACAATGCTCGAGCATTGTCACTATCTCCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-2595s21c1
Sequence:CCGGATGGAAGAACTGGCGGCTTAACTCGAGTTAAGCCGCCAGTTCTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-356s21c1
Sequence:CCGGGCTTGTCTGTCACCTGCAAATCTCGAGATTTGCAGGTGACAGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000527.3-3410s21c1
Sequence:CCGGGAGTCACTGGTCACCCTTAATCTCGAGATTAAGGGTGACCAGTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000527
VALIDATED
LDLR MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-1137s1c1
Sequence:CCGGCCAGCGAAGATGCGAAGATATCTCGAGATATCTTCGCATCTTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-201s1c1
Sequence:CCGGCGGGAAATGCATCTCCTACAACTCGAGTTGTAGGAGATGCATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000527.2-2587s1c1
Sequence:CCGGACAGAGGATGAGGTCCACATTCTCGAGAATGTGGACCTCATCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-1071s1c1
Sequence:CCGGCCACGTCTGCAATGACCTTAACTCGAGTTAAGGTCATTGCAGACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-1927s1c1
Sequence:CCGGGCCGTCTTTGAGGACAAAGTACTCGAGTACTTTGTCCTCAAAGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-964s21c1
Sequence:CCGGGATGAAGTTGGCTGCGTTAATCTCGAGATTAACGCAGCCAACTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-2337s21c1
Sequence:CCGGGACATCCACCGTCAGGCTAAACTCGAGTTTAGCCTGACGGTGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-2618s21c1
Sequence:CCGGACATCAACAGCATCAACTTTGCTCGAGCAAAGTTGATGCTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-1781s21c1
Sequence:CCGGCTCCCGCCAAGATCAAGAAAGCTCGAGCTTTCTTGATCTTGGCGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-237s21c1
Sequence:CCGGGGGCGACAGATGCGAAAGAAACTCGAGTTTCTTTCGCATCTGTCGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-2449s21c1
Sequence:CCGGACGGTGGAGATAGTGACAATGCTCGAGCATTGTCACTATCTCCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-2595s21c1
Sequence:CCGGATGGAAGAACTGGCGGCTTAACTCGAGTTAAGCCGCCAGTTCTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-356s21c1
Sequence:CCGGGCTTGTCTGTCACCTGCAAATCTCGAGATTTGCAGGTGACAGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000527.3-3410s21c1
Sequence:CCGGGAGTCACTGGTCACCCTTAATCTCGAGATTAAGGGTGACCAGTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000527
VALIDATED
LDLR MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-1137s1c1
Sequence:CCGGCCAGCGAAGATGCGAAGATATCTCGAGATATCTTCGCATCTTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-201s1c1
Sequence:CCGGCGGGAAATGCATCTCCTACAACTCGAGTTGTAGGAGATGCATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000527.2-2587s1c1
Sequence:CCGGACAGAGGATGAGGTCCACATTCTCGAGAATGTGGACCTCATCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-1071s1c1
Sequence:CCGGCCACGTCTGCAATGACCTTAACTCGAGTTAAGGTCATTGCAGACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000527.2-1927s1c1
Sequence:CCGGGCCGTCTTTGAGGACAAAGTACTCGAGTACTTTGTCCTCAAAGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-964s21c1
Sequence:CCGGGATGAAGTTGGCTGCGTTAATCTCGAGATTAACGCAGCCAACTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-2337s21c1
Sequence:CCGGGACATCCACCGTCAGGCTAAACTCGAGTTTAGCCTGACGGTGGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-2618s21c1
Sequence:CCGGACATCAACAGCATCAACTTTGCTCGAGCAAAGTTGATGCTGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-1781s21c1
Sequence:CCGGCTCCCGCCAAGATCAAGAAAGCTCGAGCTTTCTTGATCTTGGCGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-237s21c1
Sequence:CCGGGGGCGACAGATGCGAAAGAAACTCGAGTTTCTTTCGCATCTGTCGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-2449s21c1
Sequence:CCGGACGGTGGAGATAGTGACAATGCTCGAGCATTGTCACTATCTCCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000527.3-2595s21c1
Sequence:CCGGATGGAAGAACTGGCGGCTTAACTCGAGTTAAGCCGCCAGTTCTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000527.3-356s21c1
Sequence:CCGGGCTTGTCTGTCACCTGCAAATCTCGAGATTTGCAGGTGACAGACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000527.3-3410s21c1
Sequence:CCGGGAGTCACTGGTCACCCTTAATCTCGAGATTAAGGGTGACCAGTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010700
LDLR MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-1457s1c1
Sequence:CCGGGCAACATCTACTGGACAGATTCTCGAGAATCTGTCCAGTAGATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-2457s1c1
Sequence:CCGGCATCACAATCAACAGCATAAACTCGAGTTTATGCTGTTGATTGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-1304s1c1
Sequence:CCGGCGGAGGTGACCAACAATAGAACTCGAGTTCTATTGTTGGTCACCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-1864s1c1
Sequence:CCGGGATGTCATAAACGAAGCCATTCTCGAGAATGGCTTCGTTTATGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-642s21c1
Sequence:CCGGTCCGCTGCAACTCATCCATATCTCGAGATATGGATGAGTTGCAGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010700.2-3407s21c1
Sequence:CCGGAGTCGCCATTCTCCCTTAATACTCGAGTATTAAGGGAGAATGGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-1124s21c1
Sequence:CCGGTGCAAGACCAACGAGTGTTTGCTCGAGCAAACACTCGTTGGTCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-2087s21c1
Sequence:CCGGACGGGTTCAGATGTGAATTTGCTCGAGCAAATTCACATCTGAACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-382s21c1
Sequence:CCGGCACCTGTCAGTCCAATCAATTCTCGAGAATTGATTGGACTGACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010700
LDLR MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-1457s1c1
Sequence:CCGGGCAACATCTACTGGACAGATTCTCGAGAATCTGTCCAGTAGATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-2457s1c1
Sequence:CCGGCATCACAATCAACAGCATAAACTCGAGTTTATGCTGTTGATTGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-1304s1c1
Sequence:CCGGCGGAGGTGACCAACAATAGAACTCGAGTTCTATTGTTGGTCACCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-1864s1c1
Sequence:CCGGGATGTCATAAACGAAGCCATTCTCGAGAATGGCTTCGTTTATGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-642s21c1
Sequence:CCGGTCCGCTGCAACTCATCCATATCTCGAGATATGGATGAGTTGCAGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010700.2-3407s21c1
Sequence:CCGGAGTCGCCATTCTCCCTTAATACTCGAGTATTAAGGGAGAATGGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-1124s21c1
Sequence:CCGGTGCAAGACCAACGAGTGTTTGCTCGAGCAAACACTCGTTGGTCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-2087s21c1
Sequence:CCGGACGGGTTCAGATGTGAATTTGCTCGAGCAAATTCACATCTGAACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-382s21c1
Sequence:CCGGCACCTGTCAGTCCAATCAATTCTCGAGAATTGATTGGACTGACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010700
LDLR MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-1457s1c1
Sequence:CCGGGCAACATCTACTGGACAGATTCTCGAGAATCTGTCCAGTAGATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-2457s1c1
Sequence:CCGGCATCACAATCAACAGCATAAACTCGAGTTTATGCTGTTGATTGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-1304s1c1
Sequence:CCGGCGGAGGTGACCAACAATAGAACTCGAGTTCTATTGTTGGTCACCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010700.1-1864s1c1
Sequence:CCGGGATGTCATAAACGAAGCCATTCTCGAGAATGGCTTCGTTTATGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-642s21c1
Sequence:CCGGTCCGCTGCAACTCATCCATATCTCGAGATATGGATGAGTTGCAGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010700.2-3407s21c1
Sequence:CCGGAGTCGCCATTCTCCCTTAATACTCGAGTATTAAGGGAGAATGGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-1124s21c1
Sequence:CCGGTGCAAGACCAACGAGTGTTTGCTCGAGCAAACACTCGTTGGTCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-2087s21c1
Sequence:CCGGACGGGTTCAGATGTGAATTTGCTCGAGCAAATTCACATCTGAACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010700.2-382s21c1
Sequence:CCGGCACCTGTCAGTCCAATCAATTCTCGAGAATTGATTGGACTGACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)