EMAIL THIS PAGE TO A FRIEND

LDLRAD1

low density lipoprotein receptor class A domain containing 1

53 Gene Product Result for
UniProtKB ID: Q5T700, A0PJY0, Q5T6Z9
Gene ID:
Mouse(546840) low density lipoprotein receptor class A domain containing 1
Rat(689088) low density lipoprotein receptor class A domain containing 1
domestic guinea pig(100735433) low density lipoprotein receptor class A domain containing 1
naked mole-rat(101702932) low density lipoprotein receptor class A domain containing 1
sheep(101117467) low density lipoprotein receptor class A domain containing 1
chicken(772294) low density lipoprotein receptor class A domain containing 1
dog(610617) low density lipoprotein receptor class A domain containing 1
domestic cat(101095999) low density lipoprotein receptor class A domain containing 1
cow(784181) low density lipoprotein receptor class A domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010978 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231321 MISSION® esiRNA esiRNA targeting human LDLRAD1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010978 Rosetta Predictions human pricing
XM_001069480 Rosetta Predictions rat pricing
NM_001081272 Rosetta Predictions mouse pricing
XM_621633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149145 predicted 224
2 SASI_Hs01_00149148 predicted 477
3 SASI_Hs01_00149149 predicted 528
4 SASI_Hs01_00149150 predicted 521
5 SASI_Hs01_00149151 predicted 465
6 SASI_Hs01_00149152 predicted 271
7 SASI_Hs01_00149153 predicted 563
8 SASI_Hs01_00149154 predicted 544
9 SASI_Hs02_00305950 predicted 538
10 SASI_Hs02_00305951 predicted 408
11 SASI_Hs01_00149146 predicted 531
12 SASI_Hs01_00149147 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328226 predicted 194
2 SASI_Rn02_00328227 predicted 360
3 SASI_Rn02_00328228 predicted 285
4 SASI_Rn02_00328229 predicted 767
5 SASI_Rn02_00328230 predicted 465
6 SASI_Rn02_00328231 predicted 767
7 SASI_Rn02_00328232 predicted 461
8 SASI_Rn02_00328233 predicted 862
9 SASI_Rn02_00328234 predicted 578
10 SASI_Rn02_00328235 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296847 predicted 544
2 SASI_Mm02_00296848 predicted 529
3 SASI_Mm02_00296849 predicted 298
4 SASI_Mm02_00296850 predicted 355
5 SASI_Mm02_00296851 predicted 652
6 SASI_Mm02_00296852 predicted 560
7 SASI_Mm02_00296853 predicted 345
8 SASI_Mm02_00296854 predicted 622
9 SASI_Mm02_00296855 predicted 342
10 SASI_Mm02_00296856 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261135 predicted 549
2 SASI_Mm01_00261136 predicted 531
3 SASI_Mm01_00261137 predicted 301
4 SASI_Mm01_00261138 predicted 362
5 SASI_Mm01_00261139 predicted 656
6 SASI_Mm01_00261140 predicted 568
7 SASI_Mm01_00261141 predicted 355
8 SASI_Mm01_00261142 predicted 636
9 SASI_Mm01_00261143 predicted 354
10 SASI_Mm01_00261144 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081272
LDLRAD1 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor class A domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-361s21c1
Sequence:CCGGAGAGTAACATCACCACTAGAACTCGAGTTCTAGTGGTGATGTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-730s21c1
Sequence:CCGGGGATCTACTCAGACCAGAAATCTCGAGATTTCTGGTCTGAGTAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-324s21c1
Sequence:CCGGCCAGCCTGCTTCTGGTTTCTTCTCGAGAAGAAACCAGAAGCAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-534s21c1
Sequence:CCGGACTCACTCCTGCGTGACACTACTCGAGTAGTGTCACGCAGGAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-556s21c1
Sequence:CCGGCCAACAGGACAGGGTTCTTGTCTCGAGACAAGAACCCTGTCCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081272
LDLRAD1 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor class A domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000270552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-361s21c1
Sequence:CCGGAGAGTAACATCACCACTAGAACTCGAGTTCTAGTGGTGATGTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-730s21c1
Sequence:CCGGGGATCTACTCAGACCAGAAATCTCGAGATTTCTGGTCTGAGTAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-324s21c1
Sequence:CCGGCCAGCCTGCTTCTGGTTTCTTCTCGAGAAGAAACCAGAAGCAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-534s21c1
Sequence:CCGGACTCACTCCTGCGTGACACTACTCGAGTAGTGTCACGCAGGAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-556s21c1
Sequence:CCGGCCAACAGGACAGGGTTCTTGTCTCGAGACAAGAACCCTGTCCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081272
LDLRAD1 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor class A domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000270552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-361s21c1
Sequence:CCGGAGAGTAACATCACCACTAGAACTCGAGTTCTAGTGGTGATGTTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-730s21c1
Sequence:CCGGGGATCTACTCAGACCAGAAATCTCGAGATTTCTGGTCTGAGTAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-324s21c1
Sequence:CCGGCCAGCCTGCTTCTGGTTTCTTCTCGAGAAGAAACCAGAAGCAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-534s21c1
Sequence:CCGGACTCACTCCTGCGTGACACTACTCGAGTAGTGTCACGCAGGAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081272.1-556s21c1
Sequence:CCGGCCAACAGGACAGGGTTCTTGTCTCGAGACAAGAACCCTGTCCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010978
LDLRAD1 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor class A domain containing 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000155721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-191s1c1
Sequence:CCGGCCATTCTTGGACTCCCATCATCTCGAGATGATGGGAGTCCAAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-218s1c1
Sequence:CCGGCAGGAGCCCAAGCTTGTATAACTCGAGTTATACAAGCTTGGGCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-416s1c1
Sequence:CCGGCCTGGATCTACTCAGACCAAACTCGAGTTTGGTCTGAGTAGATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-183s1c1
Sequence:CCGGCTTGGTCACCATTCTTGGACTCTCGAGAGTCCAAGAATGGTGACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010978
LDLRAD1 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor class A domain containing 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000155721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-191s1c1
Sequence:CCGGCCATTCTTGGACTCCCATCATCTCGAGATGATGGGAGTCCAAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-218s1c1
Sequence:CCGGCAGGAGCCCAAGCTTGTATAACTCGAGTTATACAAGCTTGGGCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-416s1c1
Sequence:CCGGCCTGGATCTACTCAGACCAAACTCGAGTTTGGTCTGAGTAGATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-183s1c1
Sequence:CCGGCTTGGTCACCATTCTTGGACTCTCGAGAGTCCAAGAATGGTGACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010978
LDLRAD1 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor class A domain containing 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000155721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-191s1c1
Sequence:CCGGCCATTCTTGGACTCCCATCATCTCGAGATGATGGGAGTCCAAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-218s1c1
Sequence:CCGGCAGGAGCCCAAGCTTGTATAACTCGAGTTATACAAGCTTGGGCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-416s1c1
Sequence:CCGGCCTGGATCTACTCAGACCAAACTCGAGTTTGGTCTGAGTAGATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010978.2-183s1c1
Sequence:CCGGCTTGGTCACCATTCTTGGACTCTCGAGAGTCCAAGAATGGTGACCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)