EMAIL THIS PAGE TO A FRIEND

LDLRAD2

low density lipoprotein receptor class A domain containing 2

138 Gene Product Result for
UniProtKB ID: Q5SZI1, B9EJB3, Q6ZSN5
Gene ID:
Mouse(435811) low density lipoprotein receptor A domain containing 2
Rat(502992) low density lipoprotein receptor class A domain containing 2
cow(520964) low density lipoprotein receptor class A domain containing 2
domestic cat(101094276) low density lipoprotein receptor class A domain containing 2
dog(612372) low density lipoprotein receptor class A domain containing 2
sheep(101122933) low density lipoprotein receptor class A domain containing 2
domestic guinea pig(100725122) low density lipoprotein receptor class A domain containing 2
naked mole-rat(101697121) low density lipoprotein receptor class A domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013693 Rosetta Predictions human pricing
XM_001070032 Rosetta Predictions rat pricing
XM_578500 Rosetta Predictions rat pricing
NM_001033979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149928 predicted 1208
2 SASI_Hs01_00149929 predicted 997
3 SASI_Hs01_00149930 predicted 993
4 SASI_Hs01_00149933 predicted 777
5 SASI_Hs01_00149935 predicted 916
6 SASI_Hs01_00149936 predicted 1143
7 SASI_Hs01_00149937 predicted 1245
8 SASI_Hs02_00306464 predicted 801
9 SASI_Hs02_00306465 predicted 1289
10 SASI_Hs02_00306466 predicted 1239
11 SASI_Hs01_00149931 predicted 1077
12 SASI_Hs01_00149932 predicted 1152
13 SASI_Hs01_00149934 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330181 predicted 1107
2 SASI_Rn02_00330182 predicted 319
3 SASI_Rn02_00330183 predicted 327
4 SASI_Rn02_00330184 predicted 1090
5 SASI_Rn02_00330185 predicted 472
6 SASI_Rn02_00330186 predicted 872
7 SASI_Rn02_00330187 predicted 218
8 SASI_Rn02_00330188 predicted 1090
9 SASI_Rn02_00330189 predicted 213
10 SASI_Rn02_00330190 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408007 predicted 851
2 SASI_Rn02_00408008 predicted 1105
3 SASI_Rn02_00408009 predicted 697
4 SASI_Rn02_00408010 predicted 1091
5 SASI_Rn02_00408011 predicted 877
6 SASI_Rn02_00408012 predicted 1091
7 SASI_Rn02_00408013 predicted 1086
8 SASI_Rn02_00408014 predicted 911
9 SASI_Rn02_00408015 predicted 779
10 SASI_Rn02_00408016 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289058 predicted 519
2 SASI_Mm02_00289059 predicted 278
3 SASI_Mm02_00289060 predicted 623
4 SASI_Mm02_00289061 predicted 527
5 SASI_Mm02_00289062 predicted 622
6 SASI_Mm02_00289063 predicted 619
7 SASI_Mm02_00289064 predicted 624
8 SASI_Mm02_00289065 predicted 287
9 SASI_Mm02_00289066 predicted 1045
10 SASI_Mm02_00289067 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013693
LDLRAD2 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor class A domain containing 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-1635s1c1
Sequence:CCGGCGGCACTAAAGACAATTCCCACTCGAGTGGGAATTGTCTTTAGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3802s1c1
Sequence:CCGGCAATGAGATGTAGGCAAGAAACTCGAGTTTCTTGCCTACATCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-1637s1c1
Sequence:CCGGGCACTAAAGACAATTCCCAATCTCGAGATTGGGAATTGTCTTTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3790s1c1
Sequence:CCGGGAGCAGTTCTTTCAATGAGATCTCGAGATCTCATTGAAAGAACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-3843s1c1
Sequence:CCGGCCTGCAACTTTGTTACTAGTACTCGAGTACTAGTAACAAAGTTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3780s1c1
Sequence:CCGGCACTGAAATTGAGCAGTTCTTCTCGAGAAGAACTGCTCAATTTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3527s1c1
Sequence:CCGGGAAGCCATCATCGTGGAAATACTCGAGTATTTCCACGATGATGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-3819s1c1
Sequence:CCGGGAAACCAAAGTAGCAGTGGTACTCGAGTACCACTGCTACTTTGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-2668s1c1
Sequence:CCGGCCACAAACACAGCTTCCTCATCTCGAGATGAGGAAGCTGTGTTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013693.1-855s1c1
Sequence:CCGGCAGGAAGTACAGATGCCCATACTCGAGTATGGGCATCTGTACTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-2606s1c1
Sequence:CCGGCTCAGAAGTCTGTCCCTGTTTCTCGAGAAACAGGGACAGACTTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013693.1-858s1c1
Sequence:CCGGGAAGTACAGATGCCCATACCTCTCGAGAGGTATGGGCATCTGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-3731s1c1
Sequence:CCGGCCTATGACCTTGGATGGGAAACTCGAGTTTCCCATCCAAGGTCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013693
LDLRAD2 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor class A domain containing 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-1635s1c1
Sequence:CCGGCGGCACTAAAGACAATTCCCACTCGAGTGGGAATTGTCTTTAGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3802s1c1
Sequence:CCGGCAATGAGATGTAGGCAAGAAACTCGAGTTTCTTGCCTACATCTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-1637s1c1
Sequence:CCGGGCACTAAAGACAATTCCCAATCTCGAGATTGGGAATTGTCTTTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3790s1c1
Sequence:CCGGGAGCAGTTCTTTCAATGAGATCTCGAGATCTCATTGAAAGAACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-3843s1c1
Sequence:CCGGCCTGCAACTTTGTTACTAGTACTCGAGTACTAGTAACAAAGTTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3780s1c1
Sequence:CCGGCACTGAAATTGAGCAGTTCTTCTCGAGAAGAACTGCTCAATTTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3527s1c1
Sequence:CCGGGAAGCCATCATCGTGGAAATACTCGAGTATTTCCACGATGATGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-3819s1c1
Sequence:CCGGGAAACCAAAGTAGCAGTGGTACTCGAGTACCACTGCTACTTTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-2668s1c1
Sequence:CCGGCCACAAACACAGCTTCCTCATCTCGAGATGAGGAAGCTGTGTTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013693.1-855s1c1
Sequence:CCGGCAGGAAGTACAGATGCCCATACTCGAGTATGGGCATCTGTACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-2606s1c1
Sequence:CCGGCTCAGAAGTCTGTCCCTGTTTCTCGAGAAACAGGGACAGACTTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013693.1-858s1c1
Sequence:CCGGGAAGTACAGATGCCCATACCTCTCGAGAGGTATGGGCATCTGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-3731s1c1
Sequence:CCGGCCTATGACCTTGGATGGGAAACTCGAGTTTCCCATCCAAGGTCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013693
LDLRAD2 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor class A domain containing 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-1635s1c1
Sequence:CCGGCGGCACTAAAGACAATTCCCACTCGAGTGGGAATTGTCTTTAGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3802s1c1
Sequence:CCGGCAATGAGATGTAGGCAAGAAACTCGAGTTTCTTGCCTACATCTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-1637s1c1
Sequence:CCGGGCACTAAAGACAATTCCCAATCTCGAGATTGGGAATTGTCTTTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3790s1c1
Sequence:CCGGGAGCAGTTCTTTCAATGAGATCTCGAGATCTCATTGAAAGAACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-3843s1c1
Sequence:CCGGCCTGCAACTTTGTTACTAGTACTCGAGTACTAGTAACAAAGTTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3780s1c1
Sequence:CCGGCACTGAAATTGAGCAGTTCTTCTCGAGAAGAACTGCTCAATTTCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-3527s1c1
Sequence:CCGGGAAGCCATCATCGTGGAAATACTCGAGTATTTCCACGATGATGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-3819s1c1
Sequence:CCGGGAAACCAAAGTAGCAGTGGTACTCGAGTACCACTGCTACTTTGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-2668s1c1
Sequence:CCGGCCACAAACACAGCTTCCTCATCTCGAGATGAGGAAGCTGTGTTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013693.1-855s1c1
Sequence:CCGGCAGGAAGTACAGATGCCCATACTCGAGTATGGGCATCTGTACTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013693.1-2606s1c1
Sequence:CCGGCTCAGAAGTCTGTCCCTGTTTCTCGAGAAACAGGGACAGACTTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013693.1-858s1c1
Sequence:CCGGGAAGTACAGATGCCCATACCTCTCGAGAGGTATGGGCATCTGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013693.1-3731s1c1
Sequence:CCGGCCTATGACCTTGGATGGGAAACTCGAGTTTCCCATCCAAGGTCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033979
LDLRAD2 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor class A domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-600s21c1
Sequence:CCGGGAACCAGGGAGGTCATCGTTACTCGAGTAACGATGACCTCCCTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033979.1-1457s21c1
Sequence:CCGGCACCTATATACCCGTAGATATCTCGAGATATCTACGGGTATATAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-278s21c1
Sequence:CCGGGGACATTGGAAGATAACAGTTCTCGAGAACTGTTATCTTCCAATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-519s21c1
Sequence:CCGGCTGTGCAGCCTGCAATGTTTGCTCGAGCAAACATTGCAGGCTGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-300s21c1
Sequence:CCGGCAAGGCGCTGACTCTTCTTGTCTCGAGACAAGAAGAGTCAGCGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033979
LDLRAD2 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor class A domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-600s21c1
Sequence:CCGGGAACCAGGGAGGTCATCGTTACTCGAGTAACGATGACCTCCCTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033979.1-1457s21c1
Sequence:CCGGCACCTATATACCCGTAGATATCTCGAGATATCTACGGGTATATAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-278s21c1
Sequence:CCGGGGACATTGGAAGATAACAGTTCTCGAGAACTGTTATCTTCCAATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-519s21c1
Sequence:CCGGCTGTGCAGCCTGCAATGTTTGCTCGAGCAAACATTGCAGGCTGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-300s21c1
Sequence:CCGGCAAGGCGCTGACTCTTCTTGTCTCGAGACAAGAAGAGTCAGCGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033979
LDLRAD2 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor class A domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-600s21c1
Sequence:CCGGGAACCAGGGAGGTCATCGTTACTCGAGTAACGATGACCTCCCTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033979.1-1457s21c1
Sequence:CCGGCACCTATATACCCGTAGATATCTCGAGATATCTACGGGTATATAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-278s21c1
Sequence:CCGGGGACATTGGAAGATAACAGTTCTCGAGAACTGTTATCTTCCAATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-519s21c1
Sequence:CCGGCTGTGCAGCCTGCAATGTTTGCTCGAGCAAACATTGCAGGCTGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033979.1-300s21c1
Sequence:CCGGCAAGGCGCTGACTCTTCTTGTCTCGAGACAAGAAGAGTCAGCGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)