EMAIL THIS PAGE TO A FRIEND

LDLRAD3

low density lipoprotein receptor class A domain containing 3

164 Gene Product Result for
Synonyms: LRAD3
UniProtKB ID: Q86YD5, B9EG81, Q8NBJ0
Gene ID:
Mouse(241576) low density lipoprotein receptor class A domain containing 3
Rat(366138) low density lipoprotein receptor class A domain containing 3
domestic guinea pig(100730600) low density lipoprotein receptor class A domain containing 3
naked mole-rat(101698631) low density lipoprotein receptor class A domain containing 3
sheep(101114902) low density lipoprotein receptor class A domain containing 3
Zebrafish(570705) low density lipoprotein receptor class A domain containing 3
cow(525908) low density lipoprotein receptor class A domain containing 3
domestic cat(101099245) low density lipoprotein receptor class A domain containing 3
dog(483423) low density lipoprotein receptor class A domain containing 3
chicken(423160) low density lipoprotein receptor class A domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038251 Anti-LDLRAD3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105898 Anti-LDLRAD3 antibody produced in rabbit affinity isolated antibody guinea pig, dog, rat, rabbit, horse, bovine, human, mouse
western blot pricing
SAB4500495 Anti-LDLRAD3 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174902 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174902 Rosetta Predictions human pricing
XM_001079308 Rosetta Predictions rat pricing
XM_345406 Rosetta Predictions rat pricing
NM_178886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201077 predicted 1100
2 SASI_Hs01_00201078 predicted 388
3 SASI_Hs01_00201079 predicted 864
4 SASI_Hs01_00201080 predicted 1065
5 SASI_Hs01_00201081 predicted 1107
6 SASI_Hs01_00201082 predicted 733
7 SASI_Hs01_00201083 predicted 1079
8 SASI_Hs01_00201085 predicted 521
9 SASI_Hs01_00201086 predicted 1161
10 SASI_Hs02_00368800 predicted 239
11 SASI_Hs01_00201084 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363930 predicted 529
2 SASI_Rn02_00363931 predicted 750
3 SASI_Rn02_00363932 predicted 756
4 SASI_Rn02_00363933 predicted 421
5 SASI_Rn02_00363934 predicted 629
6 SASI_Rn02_00363935 predicted 257
7 SASI_Rn02_00363936 predicted 861
8 SASI_Rn02_00363937 predicted 748
9 SASI_Rn02_00363938 predicted 946
10 SASI_Rn02_00363939 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398327 predicted 529
2 SASI_Rn02_00398328 predicted 745
3 SASI_Rn02_00398329 predicted 756
4 SASI_Rn02_00398330 predicted 412
5 SASI_Rn02_00398331 predicted 637
6 SASI_Rn02_00398332 predicted 258
7 SASI_Rn02_00398333 predicted 866
8 SASI_Rn02_00398334 predicted 741
9 SASI_Rn02_00398335 predicted 942
10 SASI_Rn02_00398336 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115745 predicted 1213
2 SASI_Mm01_00115746 predicted 1115
3 SASI_Mm01_00115747 predicted 515
4 SASI_Mm02_00349474 predicted 1126
5 SASI_Mm02_00349475 predicted 1128
6 SASI_Mm01_00115751 predicted 644
7 SASI_Mm01_00115752 predicted 1228
8 SASI_Mm02_00349476 predicted 1391
9 SASI_Mm01_00115753 predicted 1372
10 SASI_Mm02_00349477 predicted 1107
11 SASI_Mm01_00115748 predicted 741
12 SASI_Mm01_00115749 predicted 1484
13 SASI_Mm01_00115750 predicted 1406
14 SASI_Mm01_00115754 predicted 1501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174902
VALIDATED
LDLRAD3 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor class A domain containing 3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-631s21c1
Sequence:CCGGGAAGCGGAACAACCTCATGACCTCGAGGTCATGAGGTTGTTCCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-468s21c1
Sequence:CCGGAGGAAAGCTGTGAAAGTTCTCCTCGAGGAGAACTTTCACAGCTTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174902.2-1465s21c1
Sequence:CCGGGGTAGTTACCTTATAGCATTTCTCGAGAAATGCTATAAGGTAACTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-434s1c1
Sequence:CCGGGATGGACAGAATAACTGTCAACTCGAGTTGACAGTTATTCTGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_174902.2-522s1c1
Sequence:CCGGCAGAGAACCAACTTGTGTATTCTCGAGAATACACAAGTTGGTTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174902.2-2363s1c1
Sequence:CCGGCCCTTCTAGTTAAGGGACTATCTCGAGATAGTCCCTTAACTAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-100s1c1
Sequence:CCGGCGGGAACAACTTCACCAATGACTCGAGTCATTGGTGAAGTTGTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-400s1c1
Sequence:CCGGGAACGGCCTCTGTATTGACAACTCGAGTTGTCAATACAGAGGCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174902.2-1182s21c1
Sequence:CCGGAGTTACAGTTTGGGATATTAACTCGAGTTAATATCCCAAACTGTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-441s21c1
Sequence:CCGGAGAATAACTGTCAAGACAACACTCGAGTGTTGTCTTGACAGTTATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-202s21c1
Sequence:CCGGCTTCGACAAGAGTGATGAGAACTCGAGTTCTCATCACTCTTGTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-293s21c1
Sequence:CCGGATTGGTCGCTTCCGGTGCAATCTCGAGATTGCACCGGAAGCGACCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-878s1c1
Sequence:CCGGGACACGGAATCTCTGAACCAACTCGAGTTGGTTCAGAGATTCCGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_174902.2-109s1c1
Sequence:CCGGCTTCACCAATGAGTGCAACATCTCGAGATGTTGCACTCATTGGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_174902.2-727s1c1
Sequence:CCGGCGTCACCTACAACGTCAATAACTCGAGTTATTGACGTTGTAGGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-230s21c1
Sequence:CCGGCCCAAGGCTAAGTCGAAATGTCTCGAGACATTTCGACTTAGCCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174902
VALIDATED
LDLRAD3 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor class A domain containing 3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-631s21c1
Sequence:CCGGGAAGCGGAACAACCTCATGACCTCGAGGTCATGAGGTTGTTCCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-468s21c1
Sequence:CCGGAGGAAAGCTGTGAAAGTTCTCCTCGAGGAGAACTTTCACAGCTTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174902.2-1465s21c1
Sequence:CCGGGGTAGTTACCTTATAGCATTTCTCGAGAAATGCTATAAGGTAACTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-434s1c1
Sequence:CCGGGATGGACAGAATAACTGTCAACTCGAGTTGACAGTTATTCTGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_174902.2-522s1c1
Sequence:CCGGCAGAGAACCAACTTGTGTATTCTCGAGAATACACAAGTTGGTTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174902.2-2363s1c1
Sequence:CCGGCCCTTCTAGTTAAGGGACTATCTCGAGATAGTCCCTTAACTAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-100s1c1
Sequence:CCGGCGGGAACAACTTCACCAATGACTCGAGTCATTGGTGAAGTTGTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-400s1c1
Sequence:CCGGGAACGGCCTCTGTATTGACAACTCGAGTTGTCAATACAGAGGCCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174902.2-1182s21c1
Sequence:CCGGAGTTACAGTTTGGGATATTAACTCGAGTTAATATCCCAAACTGTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-441s21c1
Sequence:CCGGAGAATAACTGTCAAGACAACACTCGAGTGTTGTCTTGACAGTTATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-202s21c1
Sequence:CCGGCTTCGACAAGAGTGATGAGAACTCGAGTTCTCATCACTCTTGTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-293s21c1
Sequence:CCGGATTGGTCGCTTCCGGTGCAATCTCGAGATTGCACCGGAAGCGACCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-878s1c1
Sequence:CCGGGACACGGAATCTCTGAACCAACTCGAGTTGGTTCAGAGATTCCGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_174902.2-109s1c1
Sequence:CCGGCTTCACCAATGAGTGCAACATCTCGAGATGTTGCACTCATTGGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_174902.2-727s1c1
Sequence:CCGGCGTCACCTACAACGTCAATAACTCGAGTTATTGACGTTGTAGGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-230s21c1
Sequence:CCGGCCCAAGGCTAAGTCGAAATGTCTCGAGACATTTCGACTTAGCCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174902
VALIDATED
LDLRAD3 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor class A domain containing 3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-631s21c1
Sequence:CCGGGAAGCGGAACAACCTCATGACCTCGAGGTCATGAGGTTGTTCCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-468s21c1
Sequence:CCGGAGGAAAGCTGTGAAAGTTCTCCTCGAGGAGAACTTTCACAGCTTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174902.2-1465s21c1
Sequence:CCGGGGTAGTTACCTTATAGCATTTCTCGAGAAATGCTATAAGGTAACTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-434s1c1
Sequence:CCGGGATGGACAGAATAACTGTCAACTCGAGTTGACAGTTATTCTGTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_174902.2-522s1c1
Sequence:CCGGCAGAGAACCAACTTGTGTATTCTCGAGAATACACAAGTTGGTTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174902.2-2363s1c1
Sequence:CCGGCCCTTCTAGTTAAGGGACTATCTCGAGATAGTCCCTTAACTAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-100s1c1
Sequence:CCGGCGGGAACAACTTCACCAATGACTCGAGTCATTGGTGAAGTTGTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-400s1c1
Sequence:CCGGGAACGGCCTCTGTATTGACAACTCGAGTTGTCAATACAGAGGCCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174902.2-1182s21c1
Sequence:CCGGAGTTACAGTTTGGGATATTAACTCGAGTTAATATCCCAAACTGTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-441s21c1
Sequence:CCGGAGAATAACTGTCAAGACAACACTCGAGTGTTGTCTTGACAGTTATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-202s21c1
Sequence:CCGGCTTCGACAAGAGTGATGAGAACTCGAGTTCTCATCACTCTTGTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-293s21c1
Sequence:CCGGATTGGTCGCTTCCGGTGCAATCTCGAGATTGCACCGGAAGCGACCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174902.2-878s1c1
Sequence:CCGGGACACGGAATCTCTGAACCAACTCGAGTTGGTTCAGAGATTCCGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_174902.2-109s1c1
Sequence:CCGGCTTCACCAATGAGTGCAACATCTCGAGATGTTGCACTCATTGGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_174902.2-727s1c1
Sequence:CCGGCGTCACCTACAACGTCAATAACTCGAGTTATTGACGTTGTAGGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174902.2-230s21c1
Sequence:CCGGCCCAAGGCTAAGTCGAAATGTCTCGAGACATTTCGACTTAGCCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178886
VALIDATED
LDLRAD3 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor class A domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178886.1-724s1c1
Sequence:CCGGGTCACCTACAATGTCAATAATCTCGAGATTATTGACATTGTAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178886.1-723s1c1
Sequence:CCGGCGTCACCTACAATGTCAATAACTCGAGTTATTGACATTGTAGGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178886.1-198s1c1
Sequence:CCGGCTTCGACAAGAGTGACGAGAACTCGAGTTCTCGTCACTCTTGTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178886.1-2359s1c1
Sequence:CCGGCCCTTCTAGTTAAGGGACTATCTCGAGATAGTCCCTTAACTAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178886.1-624s1c1
Sequence:CCGGGCGAAAGCGAAACAACCTCATCTCGAGATGAGGTTGTTTCGCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178886
VALIDATED
LDLRAD3 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor class A domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178886.1-724s1c1
Sequence:CCGGGTCACCTACAATGTCAATAATCTCGAGATTATTGACATTGTAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178886.1-723s1c1
Sequence:CCGGCGTCACCTACAATGTCAATAACTCGAGTTATTGACATTGTAGGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178886.1-198s1c1
Sequence:CCGGCTTCGACAAGAGTGACGAGAACTCGAGTTCTCGTCACTCTTGTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178886.1-2359s1c1
Sequence:CCGGCCCTTCTAGTTAAGGGACTATCTCGAGATAGTCCCTTAACTAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178886.1-624s1c1
Sequence:CCGGGCGAAAGCGAAACAACCTCATCTCGAGATGAGGTTGTTTCGCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178886
VALIDATED
LDLRAD3 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor class A domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178886.1-724s1c1
Sequence:CCGGGTCACCTACAATGTCAATAATCTCGAGATTATTGACATTGTAGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178886.1-723s1c1
Sequence:CCGGCGTCACCTACAATGTCAATAACTCGAGTTATTGACATTGTAGGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178886.1-198s1c1
Sequence:CCGGCTTCGACAAGAGTGACGAGAACTCGAGTTCTCGTCACTCTTGTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178886.1-2359s1c1
Sequence:CCGGCCCTTCTAGTTAAGGGACTATCTCGAGATAGTCCCTTAACTAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178886.1-624s1c1
Sequence:CCGGGCGAAAGCGAAACAACCTCATCTCGAGATGAGGTTGTTTCGCTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)