EMAIL THIS PAGE TO A FRIEND

LDLRAD4

low density lipoprotein receptor class A domain containing 4

193 Gene Product Result for
Synonyms: C18orf1
Gene ID:
Mouse(52662) low density lipoprotein receptor class A domain containing 4
Rat(679578) low density lipoprotein receptor class A domain containing 4
dog(483983) low density lipoprotein receptor class A domain containing 4
domestic cat(101094138) low density lipoprotein receptor class A domain containing 4
cow(511553) low density lipoprotein receptor class A domain containing 4
sheep(101107751) low density lipoprotein receptor class A domain containing 4
domestic guinea pig(100731535) low density lipoprotein receptor class A domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_004338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003674 Rosetta Predictions human pricing
NM_001003675 Rosetta Predictions human pricing
NM_004338 Rosetta Predictions human pricing
NM_181481 Rosetta Predictions human pricing
NM_181482 Rosetta Predictions human pricing
NM_181483 Rosetta Predictions human pricing
XM_001053570 Rosetta Predictions rat pricing
NM_172631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043600 predicted 1551
2 SASI_Hs01_00043601 predicted 2233
3 SASI_Hs01_00043602 predicted 1929
4 SASI_Hs01_00043603 predicted 1768
5 SASI_Hs01_00043604 predicted 1959
6 SASI_Hs01_00043605 predicted 2164
7 SASI_Hs01_00043607 predicted 1964
8 SASI_Hs01_00043608 predicted 2003
9 SASI_Hs01_00043609 predicted 1716
10 SASI_Hs02_00304304 predicted 1571
11 SASI_Hs01_00043606 predicted 2008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020002 predicted 1496
2 SASI_Hs01_00020003 predicted 2179
3 SASI_Hs01_00020004 predicted 1873
4 SASI_Hs01_00020005 predicted 1710
5 SASI_Hs01_00020006 predicted 1905
6 SASI_Hs01_00020007 predicted 2111
7 SASI_Hs01_00020009 predicted 1910
8 SASI_Hs01_00020010 predicted 1949
9 SASI_Hs01_00020011 predicted 1657
10 SASI_Hs02_00304305 predicted 1515
11 SASI_Hs01_00020008 predicted 1963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119825 predicted 698
2 SASI_Hs01_00119826 predicted 1378
3 SASI_Hs01_00119827 predicted 1066
4 SASI_Hs01_00119828 predicted 902
5 SASI_Hs01_00119829 predicted 1098
6 SASI_Hs01_00119830 predicted 1298
7 SASI_Hs01_00119832 predicted 1096
8 SASI_Hs01_00119833 predicted 1141
9 SASI_Hs01_00119834 predicted 860
10 SASI_Hs02_00337395 predicted 713
11 SASI_Hs01_00119831 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162230 predicted 1281
2 SASI_Hs01_00162231 predicted 1966
3 SASI_Hs01_00162232 predicted 1658
4 SASI_Hs01_00162233 predicted 1501
5 SASI_Hs01_00162234 predicted 1689
6 SASI_Hs01_00162235 predicted 1895
7 SASI_Hs01_00162237 predicted 1693
8 SASI_Hs01_00162238 predicted 1735
9 SASI_Hs01_00162239 predicted 1446
10 SASI_Hs02_00370100 predicted 1299
11 SASI_Hs01_00162236 predicted 1742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235687 predicted 1234
2 SASI_Hs01_00235688 predicted 1915
3 SASI_Hs01_00235689 predicted 1599
4 SASI_Hs01_00235690 predicted 1439
5 SASI_Hs01_00235691 predicted 1641
6 SASI_Hs01_00235692 predicted 1838
7 SASI_Hs01_00235694 predicted 1640
8 SASI_Hs01_00235695 predicted 1676
9 SASI_Hs01_00235696 predicted 1392
10 SASI_Hs02_00370101 predicted 1245
11 SASI_Hs01_00235693 predicted 1692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047135 predicted 639
2 SASI_Hs01_00047136 predicted 1317
3 SASI_Hs01_00047137 predicted 1012
4 SASI_Hs01_00047138 predicted 851
5 SASI_Hs01_00047139 predicted 1046
6 SASI_Hs01_00047140 predicted 1246
7 SASI_Hs01_00047142 predicted 1043
8 SASI_Hs01_00047143 predicted 1093
9 SASI_Hs01_00047144 predicted 802
10 SASI_Hs02_00370102 predicted 658
11 SASI_Hs01_00047141 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272820 predicted 769
2 SASI_Rn02_00272821 predicted 1154
3 SASI_Rn02_00272822 predicted 544
4 SASI_Rn02_00272823 predicted 319
5 SASI_Rn02_00272824 predicted 1150
6 SASI_Rn02_00272825 predicted 833
7 SASI_Rn02_00272826 predicted 1067
8 SASI_Rn02_00272827 predicted 931
9 SASI_Rn02_00272828 predicted 319
10 SASI_Rn02_00272829 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099273 predicted 1904
2 SASI_Mm01_00099274 predicted 1732
3 SASI_Mm01_00099275 predicted 1957
4 SASI_Mm01_00099276 predicted 1562
5 SASI_Mm01_00099277 predicted 1645
6 SASI_Mm02_00344338 predicted 1416
7 SASI_Mm01_00099278 predicted 1402
8 SASI_Mm01_00099279 predicted 1035
9 SASI_Mm01_00099280 predicted 584
10 SASI_Mm01_00099281 predicted 621
11 SASI_Mm01_00099282 predicted 1055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172631
LDLRAD4 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor class A domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172631.3-2134s21c1
Sequence:CCGGCGTGTCGTGTGAAGTTCTATACTCGAGTATAGAACTTCACACGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172631.2-2314s1c1
Sequence:CCGGGCCGTGTACTACTGAGGTATTCTCGAGAATACCTCAGTAGTACACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172631.2-1206s1c1
Sequence:CCGGGACAGTGACTTGATAGACATTCTCGAGAATGTCTATCAAGTCACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172631.2-1418s1c1
Sequence:CCGGGAACAACTCAGAGGGCACAATCTCGAGATTGTGCCCTCTGAGTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-1206s21c1
Sequence:CCGGACAGTGACTTGATAGACATTTCTCGAGAAATGTCTATCAAGTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-1041s21c1
Sequence:CCGGCCTATGTGCAGCACGAGATTGCTCGAGCAATCTCGTGCTGCACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-756s21c1
Sequence:CCGGTCGCGCAGATCCTTATCATTGCTCGAGCAATGATAAGGATCTGCGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-592s21c1
Sequence:CCGGTGCGTTCACAGAGTGCAAATTCTCGAGAATTTGCACTCTGTGAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172631
LDLRAD4 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor class A domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172631.3-2134s21c1
Sequence:CCGGCGTGTCGTGTGAAGTTCTATACTCGAGTATAGAACTTCACACGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172631.2-2314s1c1
Sequence:CCGGGCCGTGTACTACTGAGGTATTCTCGAGAATACCTCAGTAGTACACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172631.2-1206s1c1
Sequence:CCGGGACAGTGACTTGATAGACATTCTCGAGAATGTCTATCAAGTCACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172631.2-1418s1c1
Sequence:CCGGGAACAACTCAGAGGGCACAATCTCGAGATTGTGCCCTCTGAGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-1206s21c1
Sequence:CCGGACAGTGACTTGATAGACATTTCTCGAGAAATGTCTATCAAGTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-1041s21c1
Sequence:CCGGCCTATGTGCAGCACGAGATTGCTCGAGCAATCTCGTGCTGCACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-756s21c1
Sequence:CCGGTCGCGCAGATCCTTATCATTGCTCGAGCAATGATAAGGATCTGCGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-592s21c1
Sequence:CCGGTGCGTTCACAGAGTGCAAATTCTCGAGAATTTGCACTCTGTGAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172631
LDLRAD4 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor class A domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172631.3-2134s21c1
Sequence:CCGGCGTGTCGTGTGAAGTTCTATACTCGAGTATAGAACTTCACACGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172631.2-2314s1c1
Sequence:CCGGGCCGTGTACTACTGAGGTATTCTCGAGAATACCTCAGTAGTACACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172631.2-1206s1c1
Sequence:CCGGGACAGTGACTTGATAGACATTCTCGAGAATGTCTATCAAGTCACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172631.2-1418s1c1
Sequence:CCGGGAACAACTCAGAGGGCACAATCTCGAGATTGTGCCCTCTGAGTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-1206s21c1
Sequence:CCGGACAGTGACTTGATAGACATTTCTCGAGAAATGTCTATCAAGTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-1041s21c1
Sequence:CCGGCCTATGTGCAGCACGAGATTGCTCGAGCAATCTCGTGCTGCACATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-756s21c1
Sequence:CCGGTCGCGCAGATCCTTATCATTGCTCGAGCAATGATAAGGATCTGCGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172631.3-592s21c1
Sequence:CCGGTGCGTTCACAGAGTGCAAATTCTCGAGAATTTGCACTCTGTGAACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181481
LDLRAD4 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor class A domain containing 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000438041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181481.3-1147s21c1
Sequence:CCGGCCTATGTGCAGCACGAGATTGCTCGAGCAATCTCGTGCTGCACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181481.1-661s1c1
Sequence:CCGGGTTCGCCCAAATCATCATCATCTCGAGATGATGATGATTTGGGCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181481.3-1973s21c1
Sequence:CCGGGAATAAAGAAGGAAGCATTATCTCGAGATAATGCTTCCTTCTTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181481.3-1891s21c1
Sequence:CCGGCACAGAGGTATTTGATGTATTCTCGAGAATACATCAAATACCTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181481
LDLRAD4 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor class A domain containing 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000438041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181481.3-1147s21c1
Sequence:CCGGCCTATGTGCAGCACGAGATTGCTCGAGCAATCTCGTGCTGCACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181481.1-661s1c1
Sequence:CCGGGTTCGCCCAAATCATCATCATCTCGAGATGATGATGATTTGGGCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181481.3-1973s21c1
Sequence:CCGGGAATAAAGAAGGAAGCATTATCTCGAGATAATGCTTCCTTCTTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181481.3-1891s21c1
Sequence:CCGGCACAGAGGTATTTGATGTATTCTCGAGAATACATCAAATACCTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181481
LDLRAD4 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor class A domain containing 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000438041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181481.3-1147s21c1
Sequence:CCGGCCTATGTGCAGCACGAGATTGCTCGAGCAATCTCGTGCTGCACATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181481.1-661s1c1
Sequence:CCGGGTTCGCCCAAATCATCATCATCTCGAGATGATGATGATTTGGGCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181481.3-1973s21c1
Sequence:CCGGGAATAAAGAAGGAAGCATTATCTCGAGATAATGCTTCCTTCTTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181481.3-1891s21c1
Sequence:CCGGCACAGAGGTATTTGATGTATTCTCGAGAATACATCAAATACCTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004338
LDLRAD4 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor class A domain containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-699s1c1
Sequence:CCGGCGAACCATATTTGACAGTGATCTCGAGATCACTGTCAAATATGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-909s1c1
Sequence:CCGGCTGCAGTTTCAGCAGAACAATCTCGAGATTGTTCTGCTGAAACTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-926s1c1
Sequence:CCGGCAATGCAGAGAGCACAATAGTCTCGAGACTATTGTGCTCTCTGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-945s1c1
Sequence:CCGGGTACCCATCAAAGGCAAAGATCTCGAGATCTTTGCCTTTGATGGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-937s1c1
Sequence:CCGGGCACAATAGTACCCATCAAAGCTCGAGCTTTGATGGGTACTATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004338
LDLRAD4 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor class A domain containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-699s1c1
Sequence:CCGGCGAACCATATTTGACAGTGATCTCGAGATCACTGTCAAATATGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-909s1c1
Sequence:CCGGCTGCAGTTTCAGCAGAACAATCTCGAGATTGTTCTGCTGAAACTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-926s1c1
Sequence:CCGGCAATGCAGAGAGCACAATAGTCTCGAGACTATTGTGCTCTCTGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-945s1c1
Sequence:CCGGGTACCCATCAAAGGCAAAGATCTCGAGATCTTTGCCTTTGATGGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-937s1c1
Sequence:CCGGGCACAATAGTACCCATCAAAGCTCGAGCTTTGATGGGTACTATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004338
LDLRAD4 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor class A domain containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-699s1c1
Sequence:CCGGCGAACCATATTTGACAGTGATCTCGAGATCACTGTCAAATATGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-909s1c1
Sequence:CCGGCTGCAGTTTCAGCAGAACAATCTCGAGATTGTTCTGCTGAAACTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-926s1c1
Sequence:CCGGCAATGCAGAGAGCACAATAGTCTCGAGACTATTGTGCTCTCTGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-945s1c1
Sequence:CCGGGTACCCATCAAAGGCAAAGATCTCGAGATCTTTGCCTTTGATGGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004338.1-937s1c1
Sequence:CCGGGCACAATAGTACCCATCAAAGCTCGAGCTTTGATGGGTACTATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)