EMAIL THIS PAGE TO A FRIEND

LDLRAP1

low density lipoprotein receptor adaptor protein 1

81 Gene Product Result for
Synonyms: ARH ARH1 ARH2 FHCB1 FHCB2
UniProtKB ID: Q5SW96, A2BHI5, Q6TQS9, Q8N2Y0, Q9UFI9
Gene ID:
Human(26119) Summary: The protein encoded by this gene is a cytosolic protein which contains a phosphotyrosine binding (PTD) domain. The PTD domain has been found to interact with the cytoplasmic tail of the LDL receptor. Mutations in this gene lead to LDL receptor malfunction and cause the disorder autosomal recessive hypercholesterolaemia. [provided by RefSeq, Jul 2008]
Mouse(100017) low density lipoprotein receptor adaptor protein 1
Rat(500564) low density lipoprotein receptor adaptor protein 1
chicken(419589) low density lipoprotein receptor adaptor protein 1
cow(511199) low density lipoprotein receptor adaptor protein 1
domestic cat(101099482) low density lipoprotein receptor adaptor protein 1
dog(612219) low density lipoprotein receptor adaptor protein 1
domestic guinea pig(100717934) low density lipoprotein receptor adaptor protein 1
naked mole-rat(101699111) low density lipoprotein receptor adaptor protein 1
sheep(101118341) low density lipoprotein receptor adaptor protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048641 MISSION® esiRNA esiRNA human LDLRAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015627 Rosetta Predictions human pricing
NM_001109271 Rosetta Predictions rat pricing
NM_145554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145099 predicted 434
2 SASI_Hs02_00348218 predicted 744
3 SASI_Hs01_00145100 predicted 443
4 SASI_Hs01_00145101 predicted 1062
5 SASI_Hs02_00348219 predicted 747
6 SASI_Hs01_00145103 predicted 489
7 SASI_Hs01_00145104 predicted 1264
8 SASI_Hs01_00145105 predicted 1262
9 SASI_Hs02_00348220 predicted 261
10 SASI_Hs02_00348221 predicted 829
11 SASI_Hs01_00145102 predicted 258
12 SASI_Hs01_00145106 predicted 1063
13 SASI_Hs01_00145107 predicted 389
14 SASI_Hs01_00145108 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246774 predicted 1019
2 SASI_Rn02_00246775 predicted 1211
3 SASI_Rn02_00246776 predicted 937
4 SASI_Rn02_00246777 predicted 887
5 SASI_Rn02_00246778 predicted 1349
6 SASI_Rn02_00246779 predicted 363
7 SASI_Rn02_00246780 predicted 1288
8 SASI_Rn02_00246781 predicted 1255
9 SASI_Rn02_00246782 predicted 376
10 SASI_Rn02_00246783 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024048 predicted 433
2 SASI_Mm01_00024049 predicted 1317
3 SASI_Mm02_00341046 predicted 1493
4 SASI_Mm01_00024047 predicted 1368
5 SASI_Mm02_00341047 predicted 1177
6 SASI_Mm01_00024055 predicted 942
7 SASI_Mm02_00341048 predicted 1510
8 SASI_Mm02_00341049 predicted 1373
9 SASI_Mm02_00341050 predicted 309
10 SASI_Mm02_00341051 predicted 1316
11 SASI_Mm01_00024046 predicted 719
12 SASI_Mm01_00024050 predicted 1153
13 SASI_Mm01_00024051 predicted 676
14 SASI_Mm01_00024052 predicted 1460
15 SASI_Mm01_00024053 predicted 1131
16 SASI_Mm01_00024054 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015627
LDLRAP1 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor adaptor protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015627.2-1316s21c1
Sequence:CCGGTGACATGTGCAGTGCTGTAATCTCGAGATTACAGCACTGCACATGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-159s1c1
Sequence:CCGGGATGCTGTTCAGCCTCAAGTACTCGAGTACTTGAGGCTGAACAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-399s1c1
Sequence:CCGGCGACAAGGTGTTTGCATACATCTCGAGATGTATGCAAACACCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-807s1c1
Sequence:CCGGGCTTGCCCAGTCTCGGACAAACTCGAGTTTGTCCGAGACTGGGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-556s1c1
Sequence:CCGGGAGAAAGAGAAGAGGGACAAACTCGAGTTTGTCCCTCTTCTCTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-357s1c1
Sequence:CCGGGTCCATATACAGGATCTCCTACTCGAGTAGGAGATCCTGTATATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015627
LDLRAP1 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor adaptor protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015627.2-1316s21c1
Sequence:CCGGTGACATGTGCAGTGCTGTAATCTCGAGATTACAGCACTGCACATGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-159s1c1
Sequence:CCGGGATGCTGTTCAGCCTCAAGTACTCGAGTACTTGAGGCTGAACAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-399s1c1
Sequence:CCGGCGACAAGGTGTTTGCATACATCTCGAGATGTATGCAAACACCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-807s1c1
Sequence:CCGGGCTTGCCCAGTCTCGGACAAACTCGAGTTTGTCCGAGACTGGGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-556s1c1
Sequence:CCGGGAGAAAGAGAAGAGGGACAAACTCGAGTTTGTCCCTCTTCTCTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-357s1c1
Sequence:CCGGGTCCATATACAGGATCTCCTACTCGAGTAGGAGATCCTGTATATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015627
LDLRAP1 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor adaptor protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015627.2-1316s21c1
Sequence:CCGGTGACATGTGCAGTGCTGTAATCTCGAGATTACAGCACTGCACATGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-159s1c1
Sequence:CCGGGATGCTGTTCAGCCTCAAGTACTCGAGTACTTGAGGCTGAACAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-399s1c1
Sequence:CCGGCGACAAGGTGTTTGCATACATCTCGAGATGTATGCAAACACCTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-807s1c1
Sequence:CCGGGCTTGCCCAGTCTCGGACAAACTCGAGTTTGTCCGAGACTGGGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-556s1c1
Sequence:CCGGGAGAAAGAGAAGAGGGACAAACTCGAGTTTGTCCCTCTTCTCTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015627.1-357s1c1
Sequence:CCGGGTCCATATACAGGATCTCCTACTCGAGTAGGAGATCCTGTATATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145554
VALIDATED
LDLRAP1 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor adaptor protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145554.1-2282s1c1
Sequence:CCGGGCATCCTGAATCTCAGCCAAACTCGAGTTTGGCTGAGATTCAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145554.2-422s21c1
Sequence:CCGGCATCGAGAACGTGTCCATTTACTCGAGTAAATGGACACGTTCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145554.2-725s21c1
Sequence:CCGGTACCGGGAACCTGCTGGATTTCTCGAGAAATCCAGCAGGTTCCCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145554.2-930s21c1
Sequence:CCGGTCAGCACAGGACATCCATTATCTCGAGATAATGGATGTCCTGTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145554.1-2286s1c1
Sequence:CCGGCCTGAATCTCAGCCAAACTAACTCGAGTTAGTTTGGCTGAGATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145554.2-769s21c1
Sequence:CCGGTATCTACAGTCAGCGCTAATACTCGAGTATTAGCGCTGACTGTAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145554.2-1062s21c1
Sequence:CCGGTAGACATGGGACGGACCATAACTCGAGTTATGGTCCGTCCCATGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145554.1-377s1c1
Sequence:CCGGGAACGTGTCCATTTACAGGATCTCGAGATCCTGTAAATGGACACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145554
VALIDATED
LDLRAP1 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor adaptor protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145554.1-2282s1c1
Sequence:CCGGGCATCCTGAATCTCAGCCAAACTCGAGTTTGGCTGAGATTCAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145554.2-422s21c1
Sequence:CCGGCATCGAGAACGTGTCCATTTACTCGAGTAAATGGACACGTTCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145554.2-725s21c1
Sequence:CCGGTACCGGGAACCTGCTGGATTTCTCGAGAAATCCAGCAGGTTCCCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145554.2-930s21c1
Sequence:CCGGTCAGCACAGGACATCCATTATCTCGAGATAATGGATGTCCTGTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145554.1-2286s1c1
Sequence:CCGGCCTGAATCTCAGCCAAACTAACTCGAGTTAGTTTGGCTGAGATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145554.2-769s21c1
Sequence:CCGGTATCTACAGTCAGCGCTAATACTCGAGTATTAGCGCTGACTGTAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145554.2-1062s21c1
Sequence:CCGGTAGACATGGGACGGACCATAACTCGAGTTATGGTCCGTCCCATGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145554.1-377s1c1
Sequence:CCGGGAACGTGTCCATTTACAGGATCTCGAGATCCTGTAAATGGACACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145554
VALIDATED
LDLRAP1 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor adaptor protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145554.1-2282s1c1
Sequence:CCGGGCATCCTGAATCTCAGCCAAACTCGAGTTTGGCTGAGATTCAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145554.2-422s21c1
Sequence:CCGGCATCGAGAACGTGTCCATTTACTCGAGTAAATGGACACGTTCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145554.2-725s21c1
Sequence:CCGGTACCGGGAACCTGCTGGATTTCTCGAGAAATCCAGCAGGTTCCCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145554.2-930s21c1
Sequence:CCGGTCAGCACAGGACATCCATTATCTCGAGATAATGGATGTCCTGTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145554.1-2286s1c1
Sequence:CCGGCCTGAATCTCAGCCAAACTAACTCGAGTTAGTTTGGCTGAGATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145554.2-769s21c1
Sequence:CCGGTATCTACAGTCAGCGCTAATACTCGAGTATTAGCGCTGACTGTAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145554.2-1062s21c1
Sequence:CCGGTAGACATGGGACGGACCATAACTCGAGTTATGGTCCGTCCCATGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145554.1-377s1c1
Sequence:CCGGGAACGTGTCCATTTACAGGATCTCGAGATCCTGTAAATGGACACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)