EMAIL THIS PAGE TO A FRIEND

LDOC1

leucine zipper, down-regulated in cancer 1

99 Gene Product Result for
Synonyms: BCUR1 Mar7 Mart7
UniProtKB ID: O95751, Q6IAR6
Gene ID:
Human(23641) Summary: The protein encoded by this gene contains a leucine zipper-like motif and a proline-rich region that shares marked similarity with an SH3-binding domain. The protein localizes to the nucleus and is down-regulated in some cancer cell lines. It is thought to regulate the transcriptional response mediated by the nuclear factor kappa B (NF-kappaB). The gene has been proposed as a tumor suppressor gene whose protein product may have an important role in the development and/or progression of some cancers. [provided by RefSeq, Jul 2008]
Mouse(434784) leucine zipper, down-regulated in cancer 1
Rat(367956) leucine zipper, down-regulated in cancer 1
dog(492180) leucine zipper, down-regulated in cancer 1
cow(616591) leucine zipper, down-regulated in cancer 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001018087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001018087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012317 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012317 Rosetta Predictions human pricing
XM_001055597 Rosetta Predictions rat pricing
XM_346368 Rosetta Predictions rat pricing
NM_001018087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072945 predicted 976
2 SASI_Hs01_00072946 predicted 988
3 SASI_Hs01_00072947 predicted 819
4 SASI_Hs02_00344090 predicted 924
5 SASI_Hs01_00072948 predicted 759
6 SASI_Hs02_00344091 predicted 967
7 SASI_Hs01_00072949 predicted 984
8 SASI_Hs01_00072950 predicted 923
9 SASI_Hs01_00072951 predicted 269
10 SASI_Hs01_00072953 predicted 943
11 SASI_Hs01_00072952 predicted 1027
12 SASI_Hs01_00072954 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280231 predicted 205
2 SASI_Rn02_00280232 predicted 213
3 SASI_Rn02_00280233 predicted 209
4 SASI_Rn02_00280234 predicted 207
5 SASI_Rn02_00280235 predicted 202
6 SASI_Rn02_00280236 predicted 221
7 SASI_Rn02_00280237 predicted 207
8 SASI_Rn02_00280238 predicted 151
9 SASI_Rn02_00280239 predicted 10
10 SASI_Rn02_00280240 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399354 predicted 200
2 SASI_Rn02_00399355 predicted 212
3 SASI_Rn02_00399356 predicted 209
4 SASI_Rn02_00399357 predicted 209
5 SASI_Rn02_00399358 predicted 201
6 SASI_Rn02_00399359 predicted 219
7 SASI_Rn02_00399360 predicted 205
8 SASI_Rn02_00399361 predicted 144
9 SASI_Rn02_00399362 predicted 6
10 SASI_Rn02_00399363 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135533 predicted 359
2 SASI_Mm01_00135534 predicted 311
3 SASI_Mm01_00135535 predicted 413
4 SASI_Mm01_00135536 predicted 937
5 SASI_Mm01_00135537 predicted 674
6 SASI_Mm02_00287550 predicted 1044
7 SASI_Mm01_00135538 predicted 774
8 SASI_Mm01_00135539 predicted 299
9 SASI_Mm01_00135540 predicted 762
10 SASI_Mm01_00135541 predicted 760
11 SASI_Mm01_00135542 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018087
LDOC1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper, down-regulated in cancer 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-534s1c1
Sequence:CCGGGAGGAAGAAATGGAGGAAGATCTCGAGATCTTCCTCCATTTCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-522s1c1
Sequence:CCGGGATGATGATGAAGAGGAAGAACTCGAGTTCTTCCTCTTCATCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-468s1c1
Sequence:CCGGGTTGATGAGATGAAGCAGTATCTCGAGATACTGCTTCATCTCATCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-344s1c1
Sequence:CCGGGCACTTCTGCAATGATGCCATCTCGAGATGGCATCATTGCAGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018087.1-1050s1c1
Sequence:CCGGCCAGTCTTTACCGACTGGTTACTCGAGTAACCAGTCGGTAAAGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018087
LDOC1 MISSION shRNA shRNA Plasmid DNA
leucine zipper, down-regulated in cancer 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-534s1c1
Sequence:CCGGGAGGAAGAAATGGAGGAAGATCTCGAGATCTTCCTCCATTTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-522s1c1
Sequence:CCGGGATGATGATGAAGAGGAAGAACTCGAGTTCTTCCTCTTCATCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-468s1c1
Sequence:CCGGGTTGATGAGATGAAGCAGTATCTCGAGATACTGCTTCATCTCATCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-344s1c1
Sequence:CCGGGCACTTCTGCAATGATGCCATCTCGAGATGGCATCATTGCAGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018087.1-1050s1c1
Sequence:CCGGCCAGTCTTTACCGACTGGTTACTCGAGTAACCAGTCGGTAAAGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018087
LDOC1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper, down-regulated in cancer 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-534s1c1
Sequence:CCGGGAGGAAGAAATGGAGGAAGATCTCGAGATCTTCCTCCATTTCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-522s1c1
Sequence:CCGGGATGATGATGAAGAGGAAGAACTCGAGTTCTTCCTCTTCATCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-468s1c1
Sequence:CCGGGTTGATGAGATGAAGCAGTATCTCGAGATACTGCTTCATCTCATCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018087.1-344s1c1
Sequence:CCGGGCACTTCTGCAATGATGCCATCTCGAGATGGCATCATTGCAGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018087.1-1050s1c1
Sequence:CCGGCCAGTCTTTACCGACTGGTTACTCGAGTAACCAGTCGGTAAAGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012317
LDOC1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper, down-regulated in cancer 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012317.2-344s1c1
Sequence:CCGGCCGATTCTGCAACGACGCCATCTCGAGATGGCGTCGTTGCAGAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-265s1c1
Sequence:CCGGCCGAAACGTTTAATGGCGAGACTCGAGTCTCGCCATTAAACGTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012317.2-1170s1c1
Sequence:CCGGGCAGCCAAATTGTTGACACTTCTCGAGAAGTGTCAACAATTTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-462s1c1
Sequence:CCGGGCCTTCCTCGATGAGATGAAACTCGAGTTTCATCTCATCGAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-329s1c1
Sequence:CCGGGCTCGTGAACGAGAACCGATTCTCGAGAATCGGTTCTCGTTCACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-471s1c1
Sequence:CCGGGATGAGATGAAACAGTGCTTTCTCGAGAAAGCACTGTTTCATCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-164s21c1
Sequence:CCGGCATCGAGAACAGCCAGCTCATCTCGAGATGAGCTGGCTGTTCTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012317.2-680s21c1
Sequence:CCGGCTCTCTTCATTTCTCCGTAGTCTCGAGACTACGGAGAAATGAAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-534s21c1
Sequence:CCGGGATGATTATTAGGCCCTCGACCTCGAGGTCGAGGGCCTAATAATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-364s21c1
Sequence:CCGGTGAAGGTGGCATTCCTAATCACTCGAGTGATTAGGAATGCCACCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-305s21c1
Sequence:CCGGTATCGTGCAGACGGCGTCTTACTCGAGTAAGACGCCGTCTGCACGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012317.2-931s21c1
Sequence:CCGGACATCTTCCCAGAGAACTATGCTCGAGCATAGTTCTCTGGGAAGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012317
LDOC1 MISSION shRNA shRNA Plasmid DNA
leucine zipper, down-regulated in cancer 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012317.2-344s1c1
Sequence:CCGGCCGATTCTGCAACGACGCCATCTCGAGATGGCGTCGTTGCAGAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-265s1c1
Sequence:CCGGCCGAAACGTTTAATGGCGAGACTCGAGTCTCGCCATTAAACGTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012317.2-1170s1c1
Sequence:CCGGGCAGCCAAATTGTTGACACTTCTCGAGAAGTGTCAACAATTTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-462s1c1
Sequence:CCGGGCCTTCCTCGATGAGATGAAACTCGAGTTTCATCTCATCGAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-329s1c1
Sequence:CCGGGCTCGTGAACGAGAACCGATTCTCGAGAATCGGTTCTCGTTCACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-471s1c1
Sequence:CCGGGATGAGATGAAACAGTGCTTTCTCGAGAAAGCACTGTTTCATCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-164s21c1
Sequence:CCGGCATCGAGAACAGCCAGCTCATCTCGAGATGAGCTGGCTGTTCTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012317.2-680s21c1
Sequence:CCGGCTCTCTTCATTTCTCCGTAGTCTCGAGACTACGGAGAAATGAAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-534s21c1
Sequence:CCGGGATGATTATTAGGCCCTCGACCTCGAGGTCGAGGGCCTAATAATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-364s21c1
Sequence:CCGGTGAAGGTGGCATTCCTAATCACTCGAGTGATTAGGAATGCCACCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-305s21c1
Sequence:CCGGTATCGTGCAGACGGCGTCTTACTCGAGTAAGACGCCGTCTGCACGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012317.2-931s21c1
Sequence:CCGGACATCTTCCCAGAGAACTATGCTCGAGCATAGTTCTCTGGGAAGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012317
LDOC1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper, down-regulated in cancer 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012317.2-344s1c1
Sequence:CCGGCCGATTCTGCAACGACGCCATCTCGAGATGGCGTCGTTGCAGAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-265s1c1
Sequence:CCGGCCGAAACGTTTAATGGCGAGACTCGAGTCTCGCCATTAAACGTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012317.2-1170s1c1
Sequence:CCGGGCAGCCAAATTGTTGACACTTCTCGAGAAGTGTCAACAATTTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-462s1c1
Sequence:CCGGGCCTTCCTCGATGAGATGAAACTCGAGTTTCATCTCATCGAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-329s1c1
Sequence:CCGGGCTCGTGAACGAGAACCGATTCTCGAGAATCGGTTCTCGTTCACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012317.2-471s1c1
Sequence:CCGGGATGAGATGAAACAGTGCTTTCTCGAGAAAGCACTGTTTCATCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-164s21c1
Sequence:CCGGCATCGAGAACAGCCAGCTCATCTCGAGATGAGCTGGCTGTTCTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012317.2-680s21c1
Sequence:CCGGCTCTCTTCATTTCTCCGTAGTCTCGAGACTACGGAGAAATGAAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-534s21c1
Sequence:CCGGGATGATTATTAGGCCCTCGACCTCGAGGTCGAGGGCCTAATAATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-364s21c1
Sequence:CCGGTGAAGGTGGCATTCCTAATCACTCGAGTGATTAGGAATGCCACCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012317.2-305s21c1
Sequence:CCGGTATCGTGCAGACGGCGTCTTACTCGAGTAAGACGCCGTCTGCACGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012317.2-931s21c1
Sequence:CCGGACATCTTCCCAGAGAACTATGCTCGAGCATAGTTCTCTGGGAAGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)