EMAIL THIS PAGE TO A FRIEND

LDOC1L

leucine zipper, down-regulated in cancer 1-like

178 Gene Product Result for
Synonyms: Mar6 Mart6 dJ1033E15.2
UniProtKB ID: Q6ICC9, Q6ZTR1
Gene ID:
Mouse(223732) leucine zipper, down-regulated in cancer 1-like
Rat(300114) leucine zipper, down-regulated in cancer 1-like
domestic guinea pig(101787440) leucine zipper, down-regulated in cancer 1-like
naked mole-rat(101705754) leucine zipper, down-regulated in cancer 1-like
sheep(101118686) leucine zipper, down-regulated in cancer 1-like
dog(481213) leucine zipper, down-regulated in cancer 1-like
domestic cat(101088345) leucine zipper, down-regulated in cancer 1-like
cow(786696) leucine zipper, down-regulated in cancer 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032287 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032287 Rosetta Predictions human pricing
XM_001078075 Rosetta Predictions rat pricing
XM_235542 Rosetta Predictions rat pricing
NM_177630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114359 predicted 1099
2 SASI_Hs01_00114360 predicted 1254
3 SASI_Hs01_00114362 predicted 847
4 SASI_Hs01_00114363 predicted 521
5 SASI_Hs01_00114364 predicted 1254
6 SASI_Hs01_00114365 predicted 902
7 SASI_Hs02_00359606 predicted 1418
8 SASI_Hs01_00114366 predicted 431
9 SASI_Hs01_00114367 predicted 939
10 SASI_Hs01_00114368 predicted 491
11 SASI_Hs01_00114361 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359578 predicted 888
2 SASI_Rn02_00359579 predicted 569
3 SASI_Rn02_00359580 predicted 589
4 SASI_Rn02_00359581 predicted 1031
5 SASI_Rn02_00359582 predicted 921
6 SASI_Rn02_00359583 predicted 719
7 SASI_Rn02_00359584 predicted 747
8 SASI_Rn02_00359585 predicted 740
9 SASI_Rn02_00359586 predicted 508
10 SASI_Rn02_00359587 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389449 predicted 883
2 SASI_Rn02_00389450 predicted 566
3 SASI_Rn02_00389451 predicted 587
4 SASI_Rn02_00389452 predicted 1031
5 SASI_Rn02_00389453 predicted 925
6 SASI_Rn02_00389454 predicted 719
7 SASI_Rn02_00389455 predicted 747
8 SASI_Rn02_00389456 predicted 742
9 SASI_Rn02_00389457 predicted 513
10 SASI_Rn02_00389458 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109426 predicted 1101
2 SASI_Mm01_00109427 predicted 796
3 SASI_Mm01_00109428 predicted 1482
4 SASI_Mm01_00109429 predicted 1189
5 SASI_Mm02_00347871 predicted 627
6 SASI_Mm01_00109430 predicted 1748
7 SASI_Mm01_00109431 predicted 1390
8 SASI_Mm01_00109432 predicted 1337
9 SASI_Mm01_00109433 predicted 1402
10 SASI_Mm01_00109434 predicted 931
11 SASI_Mm01_00109435 predicted 1341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032287
LDOC1L MISSION shRNA Bacterial Glycerol Stock
leucine zipper, down-regulated in cancer 1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032287.2-1460s21c1
Sequence:CCGGCCTGGTTGCCCAGTTCCTATTCTCGAGAATAGGAACTGGGCAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032287.2-850s21c1
Sequence:CCGGAGAGTTGCGGAGAACCTACAACTCGAGTTGTAGGTTCTCCGCAACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032287.2-1036s21c1
Sequence:CCGGTGCCCGAGCACGGAATCTTTACTCGAGTAAAGATTCCGTGCTCGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032287.2-1092s21c1
Sequence:CCGGCCAGGTAGCATACGCTCTTTGCTCGAGCAAAGAGCGTATGCTACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032287.2-1326s21c1
Sequence:CCGGGACTACCGCTCTGCTACTTAGCTCGAGCTAAGTAGCAGAGCGGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032287.2-2435s1c1
Sequence:CCGGCCGCCATATTTCAATGCCAAACTCGAGTTTGGCATTGAAATATGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-691s1c1
Sequence:CCGGGATGGACAGATTCATGATCTTCTCGAGAAGATCATGAATCTGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-905s1c1
Sequence:CCGGAGGAAGACTTCTGCCTCTAATCTCGAGATTAGAGGCAGAAGTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-395s1c1
Sequence:CCGGGCCCAGATGGATGACGTTATTCTCGAGAATAACGTCATCCATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-582s1c1
Sequence:CCGGCCATCTCCTCAATTACTTCAACTCGAGTTGAAGTAATTGAGGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032287
LDOC1L MISSION shRNA shRNA Plasmid DNA
leucine zipper, down-regulated in cancer 1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032287.2-1460s21c1
Sequence:CCGGCCTGGTTGCCCAGTTCCTATTCTCGAGAATAGGAACTGGGCAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032287.2-850s21c1
Sequence:CCGGAGAGTTGCGGAGAACCTACAACTCGAGTTGTAGGTTCTCCGCAACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032287.2-1036s21c1
Sequence:CCGGTGCCCGAGCACGGAATCTTTACTCGAGTAAAGATTCCGTGCTCGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032287.2-1092s21c1
Sequence:CCGGCCAGGTAGCATACGCTCTTTGCTCGAGCAAAGAGCGTATGCTACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032287.2-1326s21c1
Sequence:CCGGGACTACCGCTCTGCTACTTAGCTCGAGCTAAGTAGCAGAGCGGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032287.2-2435s1c1
Sequence:CCGGCCGCCATATTTCAATGCCAAACTCGAGTTTGGCATTGAAATATGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-691s1c1
Sequence:CCGGGATGGACAGATTCATGATCTTCTCGAGAAGATCATGAATCTGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-905s1c1
Sequence:CCGGAGGAAGACTTCTGCCTCTAATCTCGAGATTAGAGGCAGAAGTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-395s1c1
Sequence:CCGGGCCCAGATGGATGACGTTATTCTCGAGAATAACGTCATCCATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-582s1c1
Sequence:CCGGCCATCTCCTCAATTACTTCAACTCGAGTTGAAGTAATTGAGGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032287
LDOC1L MISSION shRNA Lentiviral Transduction Particles
leucine zipper, down-regulated in cancer 1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032287.2-1460s21c1
Sequence:CCGGCCTGGTTGCCCAGTTCCTATTCTCGAGAATAGGAACTGGGCAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032287.2-850s21c1
Sequence:CCGGAGAGTTGCGGAGAACCTACAACTCGAGTTGTAGGTTCTCCGCAACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032287.2-1036s21c1
Sequence:CCGGTGCCCGAGCACGGAATCTTTACTCGAGTAAAGATTCCGTGCTCGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032287.2-1092s21c1
Sequence:CCGGCCAGGTAGCATACGCTCTTTGCTCGAGCAAAGAGCGTATGCTACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032287.2-1326s21c1
Sequence:CCGGGACTACCGCTCTGCTACTTAGCTCGAGCTAAGTAGCAGAGCGGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032287.2-2435s1c1
Sequence:CCGGCCGCCATATTTCAATGCCAAACTCGAGTTTGGCATTGAAATATGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-691s1c1
Sequence:CCGGGATGGACAGATTCATGATCTTCTCGAGAAGATCATGAATCTGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-905s1c1
Sequence:CCGGAGGAAGACTTCTGCCTCTAATCTCGAGATTAGAGGCAGAAGTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-395s1c1
Sequence:CCGGGCCCAGATGGATGACGTTATTCTCGAGAATAACGTCATCCATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032287.2-582s1c1
Sequence:CCGGCCATCTCCTCAATTACTTCAACTCGAGTTGAAGTAATTGAGGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177630
LDOC1L MISSION shRNA Bacterial Glycerol Stock
leucine zipper, down-regulated in cancer 1-like
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177630.3-4086s1c1
Sequence:CCGGGTTCTCTAAGGTAGGATTATTCTCGAGAATAATCCTACCTTAGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177630.2-819s1c1
Sequence:CCGGCTCTACAGATTACTCCACCTACTCGAGTAGGTGGAGTAATCTGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-943s1c1
Sequence:CCGGGCAGATGGACAGGTTCATGATCTCGAGATCATGAACCTGTCCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-944s1c1
Sequence:CCGGCAGATGGACAGGTTCATGATTCTCGAGAATCATGAACCTGTCCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-1069s1c1
Sequence:CCGGCAGCCCTTTGCGAAACAATTACTCGAGTAATTGTTTCGCAAAGGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-818s1c1
Sequence:CCGGGCTCTACAGATTACTCCACCTCTCGAGAGGTGGAGTAATCTGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177630
LDOC1L MISSION shRNA shRNA Plasmid DNA
leucine zipper, down-regulated in cancer 1-like
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177630.3-4086s1c1
Sequence:CCGGGTTCTCTAAGGTAGGATTATTCTCGAGAATAATCCTACCTTAGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177630.2-819s1c1
Sequence:CCGGCTCTACAGATTACTCCACCTACTCGAGTAGGTGGAGTAATCTGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-943s1c1
Sequence:CCGGGCAGATGGACAGGTTCATGATCTCGAGATCATGAACCTGTCCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-944s1c1
Sequence:CCGGCAGATGGACAGGTTCATGATTCTCGAGAATCATGAACCTGTCCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-1069s1c1
Sequence:CCGGCAGCCCTTTGCGAAACAATTACTCGAGTAATTGTTTCGCAAAGGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-818s1c1
Sequence:CCGGGCTCTACAGATTACTCCACCTCTCGAGAGGTGGAGTAATCTGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177630
LDOC1L MISSION shRNA Lentiviral Transduction Particles
leucine zipper, down-regulated in cancer 1-like
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177630.3-4086s1c1
Sequence:CCGGGTTCTCTAAGGTAGGATTATTCTCGAGAATAATCCTACCTTAGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177630.2-819s1c1
Sequence:CCGGCTCTACAGATTACTCCACCTACTCGAGTAGGTGGAGTAATCTGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-943s1c1
Sequence:CCGGGCAGATGGACAGGTTCATGATCTCGAGATCATGAACCTGTCCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-944s1c1
Sequence:CCGGCAGATGGACAGGTTCATGATTCTCGAGAATCATGAACCTGTCCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-1069s1c1
Sequence:CCGGCAGCCCTTTGCGAAACAATTACTCGAGTAATTGTTTCGCAAAGGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177630.2-818s1c1
Sequence:CCGGGCTCTACAGATTACTCCACCTCTCGAGAGGTGGAGTAATCTGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)