EMAIL THIS PAGE TO A FRIEND

LEAP2

liver expressed antimicrobial peptide 2

51 Gene Product Result for
Synonyms: LEAP-2
UniProtKB ID: Q969E1, D3DQ91
Gene ID:
Human(116842) Summary: LEAP2 is a cysteine-rich cationic antimicrobial peptide (Krause et al., 2003 [PubMed 12493837]
Mouse(259301) liver-expressed antimicrobial peptide 2
Rat(497901) liver-expressed antimicrobial peptide 2
chicken(414338) liver expressed antimicrobial peptide 2
cow(282270) liver expressed antimicrobial peptide 2
domestic cat(101097296) liver expressed antimicrobial peptide 2
dog(609750) liver expressed antimicrobial peptide 2
sheep(101121678) liver expressed antimicrobial peptide 2
Domestic Rabbit(100328728) liver expressed antimicrobial peptide 2
domestic guinea pig(100135569) liver expressed antimicrobial peptide 2
naked mole-rat(101712195) liver expressed antimicrobial peptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052971 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003081 MISSION® esiRNA esiRNA targeting human LEAP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052971 Rosetta Predictions human pricing
NM_001126081 Rosetta Predictions rat pricing
NM_153069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194173 predicted 390
2 SASI_Hs01_00194174 predicted 249
3 SASI_Hs01_00194175 predicted 388
4 SASI_Hs01_00194176 predicted 353
5 SASI_Hs01_00194177 predicted 384
6 SASI_Hs01_00194178 predicted 311
7 SASI_Hs01_00194179 predicted 286
8 SASI_Hs01_00194180 predicted 396
9 SASI_Hs01_00194181 predicted 195
10 SASI_Hs01_00194182 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252823 predicted 87
2 SASI_Rn02_00252824 predicted 111
3 SASI_Rn02_00252825 predicted 110
4 SASI_Rn02_00252826 predicted 133
5 SASI_Rn02_00252827 predicted 174
6 SASI_Rn02_00252828 predicted 98
7 SASI_Rn02_00252829 predicted 173
8 SASI_Rn02_00252830 predicted 173
9 SASI_Rn02_00252831 predicted 84
10 SASI_Rn02_00252832 predicted 149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342893 predicted 201
2 SASI_Mm02_00342894 predicted 204
3 SASI_Mm02_00342895 predicted 192
4 SASI_Mm01_00042984 predicted 207
5 SASI_Mm01_00042985 predicted 252
6 SASI_Mm01_00042986 predicted 236
7 SASI_Mm01_00042987 predicted 202
8 SASI_Mm01_00042988 predicted 240
9 SASI_Mm01_00042989 predicted 375
10 SASI_Mm01_00042990 predicted 378
11 SASI_Mm01_00042991 predicted 278
12 SASI_Mm01_00042992 predicted 380
13 SASI_Mm01_00042993 predicted 185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153069
LEAP2 MISSION shRNA Bacterial Glycerol Stock
liver expressed antimicrobial peptide 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153069.2-279s1c1
Sequence:CCGGCACCTCCAACAGTGATCTGTTCTCGAGAACAGATCACTGTTGGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-204s1c1
Sequence:CCGGCTGAGTGTATCACAAGACTATCTCGAGATAGTCTTGTGATACACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178227    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153069.2-383s1c1
Sequence:CCGGGCTTTAAACTGGTCTCCATTTCTCGAGAAATGGAGACCAGTTTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-104s1c1
Sequence:CCGGCCAGTACCAGAAGTGAGTTCACTCGAGTGAACTCACTTCTGGTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-113s1c1
Sequence:CCGGGAAGTGAGTTCAGCAAAGAGACTCGAGTCTCTTTGCTGAACTCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-111s1c1
Sequence:CCGGCAGAAGTGAGTTCAGCAAAGACTCGAGTCTTTGCTGAACTCACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216442    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153069.3-311s1c1
Sequence:CCGGGGAATATTGTTAACGACATTTCTCGAGAAATGTCGTTAACAATATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153069.3-310s21c1
Sequence:CCGGGGGAATATTGTTAACGACATTCTCGAGAATGTCGTTAACAATATTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153069.3-343s21c1
Sequence:CCGGAGATAAGTGAAGTAGTCTTTGCTCGAGCAAAGACTACTTCACTTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153069.3-233s21c1
Sequence:CCGGAGACGCTGTTCCCTAAGTGTGCTCGAGCACACTTAGGGAACAGCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153069.3-81s21c1
Sequence:CCGGTGCTGGGTCAGGTCAATAGTTCTCGAGAACTATTGACCTGACCCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153069
LEAP2 MISSION shRNA shRNA Plasmid DNA
liver expressed antimicrobial peptide 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153069.2-279s1c1
Sequence:CCGGCACCTCCAACAGTGATCTGTTCTCGAGAACAGATCACTGTTGGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-204s1c1
Sequence:CCGGCTGAGTGTATCACAAGACTATCTCGAGATAGTCTTGTGATACACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178227    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153069.2-383s1c1
Sequence:CCGGGCTTTAAACTGGTCTCCATTTCTCGAGAAATGGAGACCAGTTTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-104s1c1
Sequence:CCGGCCAGTACCAGAAGTGAGTTCACTCGAGTGAACTCACTTCTGGTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-113s1c1
Sequence:CCGGGAAGTGAGTTCAGCAAAGAGACTCGAGTCTCTTTGCTGAACTCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-111s1c1
Sequence:CCGGCAGAAGTGAGTTCAGCAAAGACTCGAGTCTTTGCTGAACTCACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216442    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153069.3-311s1c1
Sequence:CCGGGGAATATTGTTAACGACATTTCTCGAGAAATGTCGTTAACAATATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153069.3-310s21c1
Sequence:CCGGGGGAATATTGTTAACGACATTCTCGAGAATGTCGTTAACAATATTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153069.3-343s21c1
Sequence:CCGGAGATAAGTGAAGTAGTCTTTGCTCGAGCAAAGACTACTTCACTTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153069.3-233s21c1
Sequence:CCGGAGACGCTGTTCCCTAAGTGTGCTCGAGCACACTTAGGGAACAGCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153069.3-81s21c1
Sequence:CCGGTGCTGGGTCAGGTCAATAGTTCTCGAGAACTATTGACCTGACCCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153069
LEAP2 MISSION shRNA Lentiviral Transduction Particles
liver expressed antimicrobial peptide 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153069.2-279s1c1
Sequence:CCGGCACCTCCAACAGTGATCTGTTCTCGAGAACAGATCACTGTTGGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-204s1c1
Sequence:CCGGCTGAGTGTATCACAAGACTATCTCGAGATAGTCTTGTGATACACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178227    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153069.2-383s1c1
Sequence:CCGGGCTTTAAACTGGTCTCCATTTCTCGAGAAATGGAGACCAGTTTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-104s1c1
Sequence:CCGGCCAGTACCAGAAGTGAGTTCACTCGAGTGAACTCACTTCTGGTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-113s1c1
Sequence:CCGGGAAGTGAGTTCAGCAAAGAGACTCGAGTCTCTTTGCTGAACTCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153069.1-111s1c1
Sequence:CCGGCAGAAGTGAGTTCAGCAAAGACTCGAGTCTTTGCTGAACTCACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216442    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153069.3-311s1c1
Sequence:CCGGGGAATATTGTTAACGACATTTCTCGAGAAATGTCGTTAACAATATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153069.3-310s21c1
Sequence:CCGGGGGAATATTGTTAACGACATTCTCGAGAATGTCGTTAACAATATTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153069.3-343s21c1
Sequence:CCGGAGATAAGTGAAGTAGTCTTTGCTCGAGCAAAGACTACTTCACTTATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153069.3-233s21c1
Sequence:CCGGAGACGCTGTTCCCTAAGTGTGCTCGAGCACACTTAGGGAACAGCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153069.3-81s21c1
Sequence:CCGGTGCTGGGTCAGGTCAATAGTTCTCGAGAACTATTGACCTGACCCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052971
VALIDATED
LEAP2 MISSION shRNA Bacterial Glycerol Stock
liver expressed antimicrobial peptide 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1692s1c1
Sequence:CCGGGAGACACCCAAGTGAAGCAATCTCGAGATTGCTTCACTTGGGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052971.1-1546s1c1
Sequence:CCGGCTGAGTGTATCACAAGGCTATCTCGAGATAGCCTTGTGATACACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052971.1-1698s1c1
Sequence:CCGGCCCAAGTGAAGCAATCTTGTACTCGAGTACAAGATTGCTTCACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1539s1c1
Sequence:CCGGGATGATTCTGAGTGTATCACACTCGAGTGTGATACACTCAGAATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1552s1c1
Sequence:CCGGGTATCACAAGGCTATGCAGAACTCGAGTTCTGCATAGCCTTGTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152490    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1403s1c1
Sequence:CCGGCATGATCTTCCTGTTGCTGTTCTCGAGAACAGCAACAGGAAGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_052971.1-1450s1c1
Sequence:CCGGCAGAAGTGAGTTCGGCAAAGACTCGAGTCTTTGCCGAACTCACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1452s1c1
Sequence:CCGGGAAGTGAGTTCGGCAAAGAGACTCGAGTCTCTTTGCCGAACTCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1550s1c1
Sequence:CCGGGTGTATCACAAGGCTATGCAGCTCGAGCTGCATAGCCTTGTGATACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052971.1-1536s1c1
Sequence:CCGGCGGGATGATTCTGAGTGTATCCTCGAGGATACACTCAGAATCATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052971.1-1401s1c1
Sequence:CCGGCTCATGATCTTCCTGTTGCTGCTCGAGCAGCAACAGGAAGATCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_052971.1-1535s1c1
Sequence:CCGGCCGGGATGATTCTGAGTGTATCTCGAGATACACTCAGAATCATCCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052971.2-70s21c1
Sequence:CCGGTGTTGCTGTTGGGCCAGATAGCTCGAGCTATCTGGCCCAACAGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052971.2-232s21c1
Sequence:CCGGGACGCTGTTCCTTAAGTGTGGCTCGAGCCACACTTAAGGAACAGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052971.2-299s21c1
Sequence:CCGGTCCGACAATGCTCCGTTCTATCTCGAGATAGAACGGAGCATTGTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052971
VALIDATED
LEAP2 MISSION shRNA shRNA Plasmid DNA
liver expressed antimicrobial peptide 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1692s1c1
Sequence:CCGGGAGACACCCAAGTGAAGCAATCTCGAGATTGCTTCACTTGGGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052971.1-1546s1c1
Sequence:CCGGCTGAGTGTATCACAAGGCTATCTCGAGATAGCCTTGTGATACACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052971.1-1698s1c1
Sequence:CCGGCCCAAGTGAAGCAATCTTGTACTCGAGTACAAGATTGCTTCACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1539s1c1
Sequence:CCGGGATGATTCTGAGTGTATCACACTCGAGTGTGATACACTCAGAATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1552s1c1
Sequence:CCGGGTATCACAAGGCTATGCAGAACTCGAGTTCTGCATAGCCTTGTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152490    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1403s1c1
Sequence:CCGGCATGATCTTCCTGTTGCTGTTCTCGAGAACAGCAACAGGAAGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_052971.1-1450s1c1
Sequence:CCGGCAGAAGTGAGTTCGGCAAAGACTCGAGTCTTTGCCGAACTCACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1452s1c1
Sequence:CCGGGAAGTGAGTTCGGCAAAGAGACTCGAGTCTCTTTGCCGAACTCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1550s1c1
Sequence:CCGGGTGTATCACAAGGCTATGCAGCTCGAGCTGCATAGCCTTGTGATACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052971.1-1536s1c1
Sequence:CCGGCGGGATGATTCTGAGTGTATCCTCGAGGATACACTCAGAATCATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052971.1-1401s1c1
Sequence:CCGGCTCATGATCTTCCTGTTGCTGCTCGAGCAGCAACAGGAAGATCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_052971.1-1535s1c1
Sequence:CCGGCCGGGATGATTCTGAGTGTATCTCGAGATACACTCAGAATCATCCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052971.2-70s21c1
Sequence:CCGGTGTTGCTGTTGGGCCAGATAGCTCGAGCTATCTGGCCCAACAGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052971.2-232s21c1
Sequence:CCGGGACGCTGTTCCTTAAGTGTGGCTCGAGCCACACTTAAGGAACAGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052971.2-299s21c1
Sequence:CCGGTCCGACAATGCTCCGTTCTATCTCGAGATAGAACGGAGCATTGTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052971
VALIDATED
LEAP2 MISSION shRNA Lentiviral Transduction Particles
liver expressed antimicrobial peptide 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1692s1c1
Sequence:CCGGGAGACACCCAAGTGAAGCAATCTCGAGATTGCTTCACTTGGGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052971.1-1546s1c1
Sequence:CCGGCTGAGTGTATCACAAGGCTATCTCGAGATAGCCTTGTGATACACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052971.1-1698s1c1
Sequence:CCGGCCCAAGTGAAGCAATCTTGTACTCGAGTACAAGATTGCTTCACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1539s1c1
Sequence:CCGGGATGATTCTGAGTGTATCACACTCGAGTGTGATACACTCAGAATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1552s1c1
Sequence:CCGGGTATCACAAGGCTATGCAGAACTCGAGTTCTGCATAGCCTTGTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152490    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1403s1c1
Sequence:CCGGCATGATCTTCCTGTTGCTGTTCTCGAGAACAGCAACAGGAAGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_052971.1-1450s1c1
Sequence:CCGGCAGAAGTGAGTTCGGCAAAGACTCGAGTCTTTGCCGAACTCACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1452s1c1
Sequence:CCGGGAAGTGAGTTCGGCAAAGAGACTCGAGTCTCTTTGCCGAACTCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052971.1-1550s1c1
Sequence:CCGGGTGTATCACAAGGCTATGCAGCTCGAGCTGCATAGCCTTGTGATACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052971.1-1536s1c1
Sequence:CCGGCGGGATGATTCTGAGTGTATCCTCGAGGATACACTCAGAATCATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052971.1-1401s1c1
Sequence:CCGGCTCATGATCTTCCTGTTGCTGCTCGAGCAGCAACAGGAAGATCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_052971.1-1535s1c1
Sequence:CCGGCCGGGATGATTCTGAGTGTATCTCGAGATACACTCAGAATCATCCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052971.2-70s21c1
Sequence:CCGGTGTTGCTGTTGGGCCAGATAGCTCGAGCTATCTGGCCCAACAGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052971.2-232s21c1
Sequence:CCGGGACGCTGTTCCTTAAGTGTGGCTCGAGCCACACTTAAGGAACAGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052971.2-299s21c1
Sequence:CCGGTCCGACAATGCTCCGTTCTATCTCGAGATAGAACGGAGCATTGTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)