EMAIL THIS PAGE TO A FRIEND

LECT1

leukocyte cell derived chemotaxin 1

68 Gene Product Result for
Synonyms: BRICD3 CHM-I CHM1 MYETS1
UniProtKB ID: O75829, Q5TAM4, Q8TAY6, Q9UM18
Gene ID:
Human(11061) Summary: This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(16840) leukocyte cell derived chemotaxin 1
Rat(81512) leukocyte cell derived chemotaxin 1
Zebrafish(791772) leukocyte cell derived chemotaxin 1
cow(281683) leukocyte cell derived chemotaxin 1
Horse(100051618) leukocyte cell derived chemotaxin 1
domestic cat(101091335) leukocyte cell derived chemotaxin 1
dog(609613) leukocyte cell derived chemotaxin 1
chicken(395600) leukocyte cell derived chemotaxin 1
sheep(101106181) leukocyte cell derived chemotaxin 1
domestic guinea pig(100734572) leukocyte cell derived chemotaxin 1
naked mole-rat(101703802) leukocyte cell derived chemotaxin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007015 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015911 MISSION® esiRNA esiRNA targeting human LECT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011705 Rosetta Predictions human pricing
NM_007015 Rosetta Predictions human pricing
NM_030854 Rosetta Predictions rat pricing
NM_010701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306024 predicted 432
2 SASI_Hs01_00189368 predicted 642
3 SASI_Hs01_00189369 predicted 665
4 SASI_Hs01_00189371 predicted 440
5 SASI_Hs01_00189372 predicted 313
6 SASI_Hs01_00189373 predicted 506
7 SASI_Hs01_00189374 predicted 348
8 SASI_Hs01_00189375 predicted 330
9 SASI_Hs01_00189376 predicted 450
10 SASI_Hs02_00306025 predicted 444
11 SASI_Hs01_00189370 predicted 585
12 SASI_Hs01_00189377 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342777 predicted 437
2 SASI_Hs01_00012804 predicted 644
3 SASI_Hs01_00012805 predicted 663
4 SASI_Hs01_00012807 predicted 444
5 SASI_Hs01_00012808 predicted 311
6 SASI_Hs01_00012809 predicted 511
7 SASI_Hs01_00012810 predicted 341
8 SASI_Hs01_00012811 predicted 335
9 SASI_Hs01_00012812 predicted 456
10 SASI_Hs02_00342778 predicted 439
11 SASI_Hs01_00012806 predicted 586
12 SASI_Hs01_00012813 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069237 predicted 358
2 SASI_Rn02_00264098 predicted 306
3 SASI_Rn01_00069238 predicted 1022
4 SASI_Rn01_00069239 predicted 1155
5 SASI_Rn01_00069240 predicted 321
6 SASI_Rn01_00069241 predicted 956
7 SASI_Rn01_00069242 predicted 664
8 SASI_Rn01_00069243 predicted 409
9 SASI_Rn01_00069244 predicted 1021
10 SASI_Rn01_00069245 predicted 1121
11 SASI_Rn01_00069246 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059152 predicted 402
2 SASI_Mm02_00319156 predicted 1059
3 SASI_Mm01_00059153 predicted 489
4 SASI_Mm01_00059154 predicted 1193
5 SASI_Mm01_00059155 predicted 985
6 SASI_Mm01_00059157 predicted 1149
7 SASI_Mm01_00059158 predicted 380
8 SASI_Mm02_00319157 predicted 368
9 SASI_Mm01_00059159 predicted 1088
10 SASI_Mm02_00319158 predicted 896
11 SASI_Mm01_00059150 predicted 647
12 SASI_Mm01_00059151 predicted 1062
13 SASI_Mm01_00059156 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007015
LECT1 MISSION shRNA Bacterial Glycerol Stock
leukocyte cell derived chemotaxin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007015.2-338s21c1
Sequence:CCGGATTACACCATGAGTATCAATGCTCGAGCATTGATACTCATGGTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007015.2-1219s21c1
Sequence:CCGGACACTCAACCTGAGCGGTTATCTCGAGATAACCGCTCAGGTTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-393s1c1
Sequence:CCGGCTACATTAAAGCGCAAGTGAACTCGAGTTCACTTGCGCTTTAATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-549s1c1
Sequence:CCGGCTTCTTGAGTTCTAAGGTGTTCTCGAGAACACCTTAGAACTCAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-600s1c1
Sequence:CCGGGCTTAAACCAACCTATCCAAACTCGAGTTTGGATAGGTTGGTTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-473s1c1
Sequence:CCGGGCAAGATCATGCCAGTCAAATCTCGAGATTTGACTGGCATGATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007015.2-820s21c1
Sequence:CCGGGGCGCTGGAAGACTGAATAATCTCGAGATTATTCAGTCTTCCAGCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007015.2-1018s21c1
Sequence:CCGGTATTACCCATGGCCTTATAATCTCGAGATTATAAGGCCATGGGTAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-712s1c1
Sequence:CCGGGCTGGAAGACTGAATAATGAACTCGAGTTCATTATTCAGTCTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-387s1c1
Sequence:CCGGGAAGTGCTACATTAAAGCGCACTCGAGTGCGCTTTAATGTAGCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007015
LECT1 MISSION shRNA shRNA Plasmid DNA
leukocyte cell derived chemotaxin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007015.2-338s21c1
Sequence:CCGGATTACACCATGAGTATCAATGCTCGAGCATTGATACTCATGGTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007015.2-1219s21c1
Sequence:CCGGACACTCAACCTGAGCGGTTATCTCGAGATAACCGCTCAGGTTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-393s1c1
Sequence:CCGGCTACATTAAAGCGCAAGTGAACTCGAGTTCACTTGCGCTTTAATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-549s1c1
Sequence:CCGGCTTCTTGAGTTCTAAGGTGTTCTCGAGAACACCTTAGAACTCAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-600s1c1
Sequence:CCGGGCTTAAACCAACCTATCCAAACTCGAGTTTGGATAGGTTGGTTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-473s1c1
Sequence:CCGGGCAAGATCATGCCAGTCAAATCTCGAGATTTGACTGGCATGATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007015.2-820s21c1
Sequence:CCGGGGCGCTGGAAGACTGAATAATCTCGAGATTATTCAGTCTTCCAGCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007015.2-1018s21c1
Sequence:CCGGTATTACCCATGGCCTTATAATCTCGAGATTATAAGGCCATGGGTAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-712s1c1
Sequence:CCGGGCTGGAAGACTGAATAATGAACTCGAGTTCATTATTCAGTCTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-387s1c1
Sequence:CCGGGAAGTGCTACATTAAAGCGCACTCGAGTGCGCTTTAATGTAGCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007015
LECT1 MISSION shRNA Lentiviral Transduction Particles
leukocyte cell derived chemotaxin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007015.2-338s21c1
Sequence:CCGGATTACACCATGAGTATCAATGCTCGAGCATTGATACTCATGGTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007015.2-1219s21c1
Sequence:CCGGACACTCAACCTGAGCGGTTATCTCGAGATAACCGCTCAGGTTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-393s1c1
Sequence:CCGGCTACATTAAAGCGCAAGTGAACTCGAGTTCACTTGCGCTTTAATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-549s1c1
Sequence:CCGGCTTCTTGAGTTCTAAGGTGTTCTCGAGAACACCTTAGAACTCAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-600s1c1
Sequence:CCGGGCTTAAACCAACCTATCCAAACTCGAGTTTGGATAGGTTGGTTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-473s1c1
Sequence:CCGGGCAAGATCATGCCAGTCAAATCTCGAGATTTGACTGGCATGATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007015.2-820s21c1
Sequence:CCGGGGCGCTGGAAGACTGAATAATCTCGAGATTATTCAGTCTTCCAGCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007015.2-1018s21c1
Sequence:CCGGTATTACCCATGGCCTTATAATCTCGAGATTATAAGGCCATGGGTAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-712s1c1
Sequence:CCGGGCTGGAAGACTGAATAATGAACTCGAGTTCATTATTCAGTCTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007015.1-387s1c1
Sequence:CCGGGAAGTGCTACATTAAAGCGCACTCGAGTGCGCTTTAATGTAGCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010701
LECT1 MISSION shRNA Bacterial Glycerol Stock
leukocyte cell derived chemotaxin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-556s1c1
Sequence:CCGGCTACATCAAAGCACAGGTGAACTCGAGTTCACCTGTGCTTTGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-555s1c1
Sequence:CCGGGCTACATCAAAGCACAGGTGACTCGAGTCACCTGTGCTTTGATGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-412s1c1
Sequence:CCGGGAAACTACAAGATGGGTCAATCTCGAGATTGACCCATCTTGTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-995s1c1
Sequence:CCGGGAAGGGATCTGCTGTATAGAACTCGAGTTCTATACAGCAGATCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010701.1-1245s1c1
Sequence:CCGGCCAAGAGACCACAAAGTATTTCTCGAGAAATACTTTGTGGTCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-1073s1c1
Sequence:CCGGCCATGGCCTTACAATTACCAACTCGAGTTGGTAATTGTAAGGCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-643s1c1
Sequence:CCGGGCCAGTTAACTACGAAGAGAACTCGAGTTCTCTTCGTAGTTAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010701.1-1211s1c1
Sequence:CCGGGTTGAGAACCAAAGAAGCATACTCGAGTATGCTTCTTTGGTTCTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-488s1c1
Sequence:CCGGGAAGCAATTGAAGTCAACGATCTCGAGATCGTTGACTTCAATTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010701
LECT1 MISSION shRNA shRNA Plasmid DNA
leukocyte cell derived chemotaxin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-556s1c1
Sequence:CCGGCTACATCAAAGCACAGGTGAACTCGAGTTCACCTGTGCTTTGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-555s1c1
Sequence:CCGGGCTACATCAAAGCACAGGTGACTCGAGTCACCTGTGCTTTGATGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-412s1c1
Sequence:CCGGGAAACTACAAGATGGGTCAATCTCGAGATTGACCCATCTTGTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-995s1c1
Sequence:CCGGGAAGGGATCTGCTGTATAGAACTCGAGTTCTATACAGCAGATCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010701.1-1245s1c1
Sequence:CCGGCCAAGAGACCACAAAGTATTTCTCGAGAAATACTTTGTGGTCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-1073s1c1
Sequence:CCGGCCATGGCCTTACAATTACCAACTCGAGTTGGTAATTGTAAGGCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-643s1c1
Sequence:CCGGGCCAGTTAACTACGAAGAGAACTCGAGTTCTCTTCGTAGTTAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010701.1-1211s1c1
Sequence:CCGGGTTGAGAACCAAAGAAGCATACTCGAGTATGCTTCTTTGGTTCTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-488s1c1
Sequence:CCGGGAAGCAATTGAAGTCAACGATCTCGAGATCGTTGACTTCAATTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010701
LECT1 MISSION shRNA Lentiviral Transduction Particles
leukocyte cell derived chemotaxin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-556s1c1
Sequence:CCGGCTACATCAAAGCACAGGTGAACTCGAGTTCACCTGTGCTTTGATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-555s1c1
Sequence:CCGGGCTACATCAAAGCACAGGTGACTCGAGTCACCTGTGCTTTGATGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-412s1c1
Sequence:CCGGGAAACTACAAGATGGGTCAATCTCGAGATTGACCCATCTTGTAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-995s1c1
Sequence:CCGGGAAGGGATCTGCTGTATAGAACTCGAGTTCTATACAGCAGATCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010701.1-1245s1c1
Sequence:CCGGCCAAGAGACCACAAAGTATTTCTCGAGAAATACTTTGTGGTCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-1073s1c1
Sequence:CCGGCCATGGCCTTACAATTACCAACTCGAGTTGGTAATTGTAAGGCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-643s1c1
Sequence:CCGGGCCAGTTAACTACGAAGAGAACTCGAGTTCTCTTCGTAGTTAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010701.1-1211s1c1
Sequence:CCGGGTTGAGAACCAAAGAAGCATACTCGAGTATGCTTCTTTGGTTCTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010701.1-488s1c1
Sequence:CCGGGAAGCAATTGAAGTCAACGATCTCGAGATCGTTGACTTCAATTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)