EMAIL THIS PAGE TO A FRIEND

LECT2

leukocyte cell-derived chemotaxin 2

64 Gene Product Result for
Synonyms: chm-II chm2
UniProtKB ID: O14960, B2RA90, O14565, Q52M49
Gene ID:
Human(3950) Summary: This gene encodes a secreted, 16 kDa protein that acts as a chemotactic factor to neutrophils and stimulates the growth of chondrocytes and osteoblasts. This protein has high sequence similarity to the chondromodulin repeat regions of the chicken myb-induced myeloid 1 protein. A polymorphism in this gene may be associated with rheumatoid arthritis. [provided by RefSeq, Jul 2008]
Mouse(16841) leukocyte cell-derived chemotaxin 2
Rat(361205) leukocyte cell-derived chemotaxin 2
domestic guinea pig(100717011) leukocyte cell-derived chemotaxin 2
naked mole-rat(101703644) leukocyte cell-derived chemotaxin 2
sheep(101105747) leukocyte cell-derived chemotaxin 2
chicken(396471) leukocyte cell-derived chemotaxin 2
domestic cat(101081021) leukocyte cell-derived chemotaxin 2
dog(474687) leukocyte cell-derived chemotaxin 2
cow(281899) leukocyte cell-derived chemotaxin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002302 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153571 MISSION® esiRNA esiRNA human LECT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002302 Rosetta Predictions human pricing
NM_001108405 Rosetta Predictions rat pricing
NM_010702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067185 predicted 458
2 SASI_Hs02_00333608 predicted 296
3 SASI_Hs01_00067186 predicted 517
4 SASI_Hs01_00067187 predicted 319
5 SASI_Hs01_00067188 predicted 406
6 SASI_Hs02_00333609 predicted 257
7 SASI_Hs01_00067189 predicted 499
8 SASI_Hs01_00067190 predicted 366
9 SASI_Hs01_00067191 predicted 469
10 SASI_Hs01_00067193 predicted 370
11 SASI_Hs01_00067192 predicted 284
12 SASI_Hs01_00067194 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238339 predicted 464
2 SASI_Rn02_00238340 predicted 577
3 SASI_Rn02_00238341 predicted 268
4 SASI_Rn02_00238342 predicted 427
5 SASI_Rn02_00238343 predicted 377
6 SASI_Rn02_00238344 predicted 431
7 SASI_Rn02_00238345 predicted 221
8 SASI_Rn02_00238346 predicted 199
9 SASI_Rn02_00238347 predicted 578
10 SASI_Rn02_00238348 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190982 predicted 532
2 SASI_Mm02_00319159 predicted 600
3 SASI_Mm01_00190984 predicted 255
4 SASI_Mm01_00190985 predicted 463
5 SASI_Mm01_00190986 predicted 596
6 SASI_Mm01_00190988 predicted 303
7 SASI_Mm01_00190989 predicted 211
8 SASI_Mm02_00319160 predicted 196
9 SASI_Mm01_00190990 predicted 311
10 SASI_Mm01_00190991 predicted 449
11 SASI_Mm01_00190983 predicted 619
12 SASI_Mm01_00190987 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010702
VALIDATED
LECT2 MISSION shRNA Bacterial Glycerol Stock
leukocyte cell-derived chemotaxin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010702.1-668s1c1
Sequence:CCGGCGTGCATTCTAACAGAAACATCTCGAGATGTTTCTGTTAGAATGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010702.1-365s1c1
Sequence:CCGGGCCAGGAGAAACCCTATAGAACTCGAGTTCTATAGGGTTTCTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010702.1-336s1c1
Sequence:CCGGGTATGCACCATTCACTGGGAACTCGAGTTCCCAGTGAATGGTGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010702.1-539s1c1
Sequence:CCGGAGTCGCATGTACACGTTGAAACTCGAGTTTCAACGTGTACATGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010702.1-216s1c1
Sequence:CCGGCAGCAAATCTTCCAACGAGATCTCGAGATCTCGTTGGAAGATTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-216s21c1
Sequence:CCGGCAGCAAATCTTCCAACGAGATCTCGAGATCTCGTTGGAAGATTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-191s21c1
Sequence:CCGGCAGGACCATGGGCTAACATATCTCGAGATATGTTAGCCCATGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-341s21c1
Sequence:CCGGCACCATTCACTGGGAAGATAGCTCGAGCTATCTTCCCAGTGAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-668s21c1
Sequence:CCGGCGTGCATTCTAACAGAAACATCTCGAGATGTTTCTGTTAGAATGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-365s21c1
Sequence:CCGGGCCAGGAGAAACCCTATAGAACTCGAGTTCTATAGGGTTTCTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010702
VALIDATED
LECT2 MISSION shRNA shRNA Plasmid DNA
leukocyte cell-derived chemotaxin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010702.1-668s1c1
Sequence:CCGGCGTGCATTCTAACAGAAACATCTCGAGATGTTTCTGTTAGAATGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010702.1-365s1c1
Sequence:CCGGGCCAGGAGAAACCCTATAGAACTCGAGTTCTATAGGGTTTCTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010702.1-336s1c1
Sequence:CCGGGTATGCACCATTCACTGGGAACTCGAGTTCCCAGTGAATGGTGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010702.1-539s1c1
Sequence:CCGGAGTCGCATGTACACGTTGAAACTCGAGTTTCAACGTGTACATGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010702.1-216s1c1
Sequence:CCGGCAGCAAATCTTCCAACGAGATCTCGAGATCTCGTTGGAAGATTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-216s21c1
Sequence:CCGGCAGCAAATCTTCCAACGAGATCTCGAGATCTCGTTGGAAGATTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-191s21c1
Sequence:CCGGCAGGACCATGGGCTAACATATCTCGAGATATGTTAGCCCATGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-341s21c1
Sequence:CCGGCACCATTCACTGGGAAGATAGCTCGAGCTATCTTCCCAGTGAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-668s21c1
Sequence:CCGGCGTGCATTCTAACAGAAACATCTCGAGATGTTTCTGTTAGAATGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-365s21c1
Sequence:CCGGGCCAGGAGAAACCCTATAGAACTCGAGTTCTATAGGGTTTCTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010702
VALIDATED
LECT2 MISSION shRNA Lentiviral Transduction Particles
leukocyte cell-derived chemotaxin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010702.1-668s1c1
Sequence:CCGGCGTGCATTCTAACAGAAACATCTCGAGATGTTTCTGTTAGAATGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010702.1-365s1c1
Sequence:CCGGGCCAGGAGAAACCCTATAGAACTCGAGTTCTATAGGGTTTCTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010702.1-336s1c1
Sequence:CCGGGTATGCACCATTCACTGGGAACTCGAGTTCCCAGTGAATGGTGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010702.1-539s1c1
Sequence:CCGGAGTCGCATGTACACGTTGAAACTCGAGTTTCAACGTGTACATGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010702.1-216s1c1
Sequence:CCGGCAGCAAATCTTCCAACGAGATCTCGAGATCTCGTTGGAAGATTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-216s21c1
Sequence:CCGGCAGCAAATCTTCCAACGAGATCTCGAGATCTCGTTGGAAGATTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-191s21c1
Sequence:CCGGCAGGACCATGGGCTAACATATCTCGAGATATGTTAGCCCATGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-341s21c1
Sequence:CCGGCACCATTCACTGGGAAGATAGCTCGAGCTATCTTCCCAGTGAATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-668s21c1
Sequence:CCGGCGTGCATTCTAACAGAAACATCTCGAGATGTTTCTGTTAGAATGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010702.1-365s21c1
Sequence:CCGGGCCAGGAGAAACCCTATAGAACTCGAGTTCTATAGGGTTTCTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002302
LECT2 MISSION shRNA Bacterial Glycerol Stock
leukocyte cell-derived chemotaxin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-601s1c1
Sequence:CCGGCAATCGCATGTGCACATTGAACTCGAGTTCAATGTGCACATGCGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002302.1-574s1c1
Sequence:CCGGCCCTTGCAGAAAGTTTATCCTCTCGAGAGGATAAACTTTCTGCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-568s1c1
Sequence:CCGGCTATTGCCCTTGCAGAAAGTTCTCGAGAACTTTCTGCAAGGGCAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-259s1c1
Sequence:CCGGCCATGGGCTAATATATGTGCTCTCGAGAGCACATATATTAGCCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-579s1c1
Sequence:CCGGGCAGAAAGTTTATCCTGGCATCTCGAGATGCCAGGATAAACTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002302.1-596s1c1
Sequence:CCGGGCATACAATCGCATGTGCACACTCGAGTGTGCACATGCGATTGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-399s1c1
Sequence:CCGGGTACGCACCATTCACTGGAATCTCGAGATTCCAGTGAATGGTGCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002302.2-780s21c1
Sequence:CCGGTTTCCATGACATGATTATTACCTCGAGGTAATAATCATGTCATGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002302.2-827s21c1
Sequence:CCGGTCACGTACCTCATAAACATATCTCGAGATATGTTTATGAGGTACGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002302.2-508s21c1
Sequence:CCGGTTCTACATTAAGCCAATTAAGCTCGAGCTTAATTGGCTTAATGTAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002302
LECT2 MISSION shRNA shRNA Plasmid DNA
leukocyte cell-derived chemotaxin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-601s1c1
Sequence:CCGGCAATCGCATGTGCACATTGAACTCGAGTTCAATGTGCACATGCGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002302.1-574s1c1
Sequence:CCGGCCCTTGCAGAAAGTTTATCCTCTCGAGAGGATAAACTTTCTGCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-568s1c1
Sequence:CCGGCTATTGCCCTTGCAGAAAGTTCTCGAGAACTTTCTGCAAGGGCAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-259s1c1
Sequence:CCGGCCATGGGCTAATATATGTGCTCTCGAGAGCACATATATTAGCCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-579s1c1
Sequence:CCGGGCAGAAAGTTTATCCTGGCATCTCGAGATGCCAGGATAAACTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002302.1-596s1c1
Sequence:CCGGGCATACAATCGCATGTGCACACTCGAGTGTGCACATGCGATTGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-399s1c1
Sequence:CCGGGTACGCACCATTCACTGGAATCTCGAGATTCCAGTGAATGGTGCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002302.2-780s21c1
Sequence:CCGGTTTCCATGACATGATTATTACCTCGAGGTAATAATCATGTCATGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002302.2-827s21c1
Sequence:CCGGTCACGTACCTCATAAACATATCTCGAGATATGTTTATGAGGTACGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002302.2-508s21c1
Sequence:CCGGTTCTACATTAAGCCAATTAAGCTCGAGCTTAATTGGCTTAATGTAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002302
LECT2 MISSION shRNA Lentiviral Transduction Particles
leukocyte cell-derived chemotaxin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-601s1c1
Sequence:CCGGCAATCGCATGTGCACATTGAACTCGAGTTCAATGTGCACATGCGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002302.1-574s1c1
Sequence:CCGGCCCTTGCAGAAAGTTTATCCTCTCGAGAGGATAAACTTTCTGCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-568s1c1
Sequence:CCGGCTATTGCCCTTGCAGAAAGTTCTCGAGAACTTTCTGCAAGGGCAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-259s1c1
Sequence:CCGGCCATGGGCTAATATATGTGCTCTCGAGAGCACATATATTAGCCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-579s1c1
Sequence:CCGGGCAGAAAGTTTATCCTGGCATCTCGAGATGCCAGGATAAACTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002302.1-596s1c1
Sequence:CCGGGCATACAATCGCATGTGCACACTCGAGTGTGCACATGCGATTGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002302.1-399s1c1
Sequence:CCGGGTACGCACCATTCACTGGAATCTCGAGATTCCAGTGAATGGTGCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002302.2-780s21c1
Sequence:CCGGTTTCCATGACATGATTATTACCTCGAGGTAATAATCATGTCATGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002302.2-827s21c1
Sequence:CCGGTCACGTACCTCATAAACATATCTCGAGATATGTTTATGAGGTACGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002302.2-508s21c1
Sequence:CCGGTTCTACATTAAGCCAATTAAGCTCGAGCTTAATTGGCTTAATGTAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)