EMAIL THIS PAGE TO A FRIEND

LEF1

lymphoid enhancer-binding factor 1

128 Gene Product Result for
Synonyms: LEF-1 TCF10 TCF1ALPHA TCF7L3
UniProtKB ID: Q9UJU2, B4DG38, B7Z8E2, E9PDK3, Q3ZCU4, Q9HAZ0
Gene ID:
Human(51176) Summary: This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(16842) lymphoid enhancer binding factor 1
Rat(161452) lymphoid enhancer binding factor 1
domestic guinea pig(100716066) lymphoid enhancer-binding factor 1
naked mole-rat(101711023) lymphoid enhancer-binding factor 1
Zebrafish(30701) lymphocyte enhancer binding factor 1
domestic cat(101088077) lymphoid enhancer-binding factor 1
cow(535399) lymphoid enhancer-binding factor 1
chicken(395865) lymphoid enhancer-binding factor 1
dog(478507) lymphoid enhancer-binding factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32404 Anti-LEF1 (AB1) antibody produced in rabbit affinity isolated antibody rabbit, mouse, bovine, pig, guinea pig, human, rabbit
western blot pricing
AV32403 Anti-LEF1 (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, canine, rabbit, human, guinea pig, bovine, horse, rat, zebrafish, mouse, pig
immunohistochemistry, western blot pricing
SAB2500590 Anti-LEF1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA002087 Anti-LEF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101332 Anti-LEF1 antibody produced in rabbit affinity isolated antibody pig, rabbit, bovine, rat, mouse, horse, guinea pig, human
western blot pricing
SAB4504256 Anti-phospho-LEF-1 (pSer42) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
L4020 Monoclonal Anti-LEF-1 (β-Catenin binding domain) antibody produced in mouse clone REMB1, ~1 mg/mL, purified immunoglobulin, buffered aqueous solution human
western blot pricing
L7901 Monoclonal Anti-LEF-1 (HMG DNA Binding Domain) antibody produced in mouse ~1 mg/mL, clone REMB6, purified immunoglobulin human
western blot pricing
L3150 Monoclonal Anti-LEF-1 (Transactivation Domain 236-242) antibody produced in mouse ~1 mg/mL, clone 3A12, purified immunoglobulin human
western blot pricing
L3276 Monoclonal Anti-LEF-1 antibody produced in mouse ~1 mg/mL, clone 1C3, purified immunoglobulin human
western blot pricing
WH0051176M3 Monoclonal Anti-LEF1 antibody produced in mouse clone 5A3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1405084 Monoclonal Anti-LEF1 antibody produced in mouse clone 3H5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002271 MISSION® esiRNA esiRNA targeting human LEF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016269 Rosetta Predictions human pricing
NM_130429 Rosetta Predictions rat pricing
NM_010703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349169 predicted 1176
2 SASI_Hs01_00151593 predicted 1795
3 SASI_Hs01_00151594 predicted 1759
4 SASI_Hs01_00151595 predicted 1590
5 SASI_Hs01_00151596 predicted 1540
6 SASI_Hs02_00349170 predicted 973
7 SASI_Hs01_00151598 predicted 1718
8 SASI_Hs02_00349171 predicted 794
9 SASI_Hs01_00151600 predicted 754
10 SASI_Hs01_00151601 predicted 1014
11 SASI_Hs01_00151592 predicted 978
12 SASI_Hs01_00151597 predicted 1674
13 SASI_Hs01_00151599 predicted 1800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081515 predicted 760
2 SASI_Rn01_00081516 predicted 828
3 SASI_Rn01_00081517 predicted 200
4 SASI_Rn02_00267442 predicted 503
5 SASI_Rn01_00081518 predicted 313
6 SASI_Rn01_00081520 predicted 786
7 SASI_Rn01_00081521 predicted 675
8 SASI_Rn01_00081522 predicted 326
9 SASI_Rn01_00081523 predicted 206
10 SASI_Rn01_00081524 predicted 463
11 SASI_Rn01_00081519 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158785 predicted 1762
2 SASI_Mm01_00158786 predicted 1363
3 SASI_Mm01_00158787 predicted 1678
4 SASI_Mm02_00319161 predicted 1516
5 SASI_Mm01_00158788 predicted 1192
6 SASI_Mm01_00158789 predicted 1094
7 SASI_Mm01_00158790 predicted 1039
8 SASI_Mm01_00158791 predicted 1259
9 SASI_Mm01_00158792 predicted 1315
10 SASI_Mm01_00158793 predicted 1816
11 SASI_Mm01_00158794 predicted 1875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016269
VALIDATED
LEF1 MISSION shRNA Bacterial Glycerol Stock
lymphoid enhancer-binding factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016269.4-2408s21c1
Sequence:CCGGGCTCATTCCCAACGTGCAAAGCTCGAGCTTTGCACGTTGGGAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-1748s21c1
Sequence:CCGGCATCCTCCAGCTCCTGATATCCTCGAGGATATCAGGAGCTGGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016269.4-2773s21c1
Sequence:CCGGACGGTAACTTGGCTGCATTTGCTCGAGCAAATGCAGCCAAGTTACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-1319s21c1
Sequence:CCGGCCCGAAGAGGAAGGCGATTTACTCGAGTAAATCGCCTTCCTCTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-1592s21c1
Sequence:CCGGATCCCGAGAACATCAAATAAACTCGAGTTTATTTGATGTTCTCGGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-2283s21c1
Sequence:CCGGGCTGGTCTGCAAGAGACAATTCTCGAGAATTGTCTCTTGCAGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016269.2-1473s1c1
Sequence:CCGGCCACACTGACAGTGACCTAATCTCGAGATTAGGTCACTGTCAGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016269.2-1177s1c1
Sequence:CCGGCCATCAGATGTCAACTCCAAACTCGAGTTTGGAGTTGACATCTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016269
VALIDATED
LEF1 MISSION shRNA shRNA Plasmid DNA
lymphoid enhancer-binding factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016269.4-2408s21c1
Sequence:CCGGGCTCATTCCCAACGTGCAAAGCTCGAGCTTTGCACGTTGGGAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-1748s21c1
Sequence:CCGGCATCCTCCAGCTCCTGATATCCTCGAGGATATCAGGAGCTGGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016269.4-2773s21c1
Sequence:CCGGACGGTAACTTGGCTGCATTTGCTCGAGCAAATGCAGCCAAGTTACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-1319s21c1
Sequence:CCGGCCCGAAGAGGAAGGCGATTTACTCGAGTAAATCGCCTTCCTCTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-1592s21c1
Sequence:CCGGATCCCGAGAACATCAAATAAACTCGAGTTTATTTGATGTTCTCGGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-2283s21c1
Sequence:CCGGGCTGGTCTGCAAGAGACAATTCTCGAGAATTGTCTCTTGCAGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016269.2-1473s1c1
Sequence:CCGGCCACACTGACAGTGACCTAATCTCGAGATTAGGTCACTGTCAGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016269.2-1177s1c1
Sequence:CCGGCCATCAGATGTCAACTCCAAACTCGAGTTTGGAGTTGACATCTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016269
VALIDATED
LEF1 MISSION shRNA Lentiviral Transduction Particles
lymphoid enhancer-binding factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016269.4-2408s21c1
Sequence:CCGGGCTCATTCCCAACGTGCAAAGCTCGAGCTTTGCACGTTGGGAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-1748s21c1
Sequence:CCGGCATCCTCCAGCTCCTGATATCCTCGAGGATATCAGGAGCTGGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016269.4-2773s21c1
Sequence:CCGGACGGTAACTTGGCTGCATTTGCTCGAGCAAATGCAGCCAAGTTACCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-1319s21c1
Sequence:CCGGCCCGAAGAGGAAGGCGATTTACTCGAGTAAATCGCCTTCCTCTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-1592s21c1
Sequence:CCGGATCCCGAGAACATCAAATAAACTCGAGTTTATTTGATGTTCTCGGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016269.4-2283s21c1
Sequence:CCGGGCTGGTCTGCAAGAGACAATTCTCGAGAATTGTCTCTTGCAGACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016269.2-1473s1c1
Sequence:CCGGCCACACTGACAGTGACCTAATCTCGAGATTAGGTCACTGTCAGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016269.2-1177s1c1
Sequence:CCGGCCATCAGATGTCAACTCCAAACTCGAGTTTGGAGTTGACATCTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010703
VALIDATED
LEF1 MISSION shRNA Bacterial Glycerol Stock
lymphoid enhancer-binding factor 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-2091s21c1
Sequence:CCGGTGGTCAGCGCGAGACAATTATCTCGAGATAATTGTCTCGCGCTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-1947s21c1
Sequence:CCGGGTAGCTGAGTGCACGCTAAAGCTCGAGCTTTAGCGTGCACTCAGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-1164s21c1
Sequence:CCGGTTGGTTAACGAGTCCGAAATCCTCGAGGATTTCGGACTCGTTAACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1360s21c1
Sequence:CCGGGCGACCCGTACATGTCAAATGCTCGAGCATTTGACATGTACGGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1146s21c1
Sequence:CCGGGCCGACATCAAGTCATCTTTGCTCGAGCAAAGATGACTTGATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1398s21c1
Sequence:CCGGATCCCGAGGACATCAAATAAACTCGAGTTTATTTGATGTCCTCGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010703.3-2200s21c1
Sequence:CCGGTGGTGGTAAGAGAAGCTCCTTCTCGAGAAGGAGCTTCTCTTACCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010703.3-2260s21c1
Sequence:CCGGTCTGGAGATGGAAGCTTGTTGCTCGAGCAACAAGCTTCCATCTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1322s21c1
Sequence:GTACCGGCAGTTACTCTGGCTACATAATCTCGAGATTATGTAGCCAGAGTAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-2213s21c1
Sequence:CCGGAGCTCCTTCCCAACGTGCAAACTCGAGTTTGCACGTTGGGAAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010703.2-2305s1c1
Sequence:CCGGCCCAAGGAACACTGACAGCAACTCGAGTTGCTGTCAGTGTTCCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-2087s1c1
Sequence:CCGGGCGAGACAATTATGGCAAGAACTCGAGTTCTTGCCATAATTGTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-1875s1c1
Sequence:CCGGCATATTAAGAAGCCTCTGAATCTCGAGATTCAGAGGCTTCTTAATATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-1133s1c1
Sequence:CCGGAGCCGACATCAAGTCATCTTTCTCGAGAAAGATGACTTGATGTCGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-1309s1c1
Sequence:CCGGCCAGTTACTCTGGCTACATAACTCGAGTTATGTAGCCAGAGTAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010703
VALIDATED
LEF1 MISSION shRNA shRNA Plasmid DNA
lymphoid enhancer-binding factor 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-2091s21c1
Sequence:CCGGTGGTCAGCGCGAGACAATTATCTCGAGATAATTGTCTCGCGCTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-1947s21c1
Sequence:CCGGGTAGCTGAGTGCACGCTAAAGCTCGAGCTTTAGCGTGCACTCAGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-1164s21c1
Sequence:CCGGTTGGTTAACGAGTCCGAAATCCTCGAGGATTTCGGACTCGTTAACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1360s21c1
Sequence:CCGGGCGACCCGTACATGTCAAATGCTCGAGCATTTGACATGTACGGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1146s21c1
Sequence:CCGGGCCGACATCAAGTCATCTTTGCTCGAGCAAAGATGACTTGATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1398s21c1
Sequence:CCGGATCCCGAGGACATCAAATAAACTCGAGTTTATTTGATGTCCTCGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010703.3-2200s21c1
Sequence:CCGGTGGTGGTAAGAGAAGCTCCTTCTCGAGAAGGAGCTTCTCTTACCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010703.3-2260s21c1
Sequence:CCGGTCTGGAGATGGAAGCTTGTTGCTCGAGCAACAAGCTTCCATCTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1322s21c1
Sequence:GTACCGGCAGTTACTCTGGCTACATAATCTCGAGATTATGTAGCCAGAGTAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-2213s21c1
Sequence:CCGGAGCTCCTTCCCAACGTGCAAACTCGAGTTTGCACGTTGGGAAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010703.2-2305s1c1
Sequence:CCGGCCCAAGGAACACTGACAGCAACTCGAGTTGCTGTCAGTGTTCCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-2087s1c1
Sequence:CCGGGCGAGACAATTATGGCAAGAACTCGAGTTCTTGCCATAATTGTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-1875s1c1
Sequence:CCGGCATATTAAGAAGCCTCTGAATCTCGAGATTCAGAGGCTTCTTAATATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-1133s1c1
Sequence:CCGGAGCCGACATCAAGTCATCTTTCTCGAGAAAGATGACTTGATGTCGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-1309s1c1
Sequence:CCGGCCAGTTACTCTGGCTACATAACTCGAGTTATGTAGCCAGAGTAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010703
VALIDATED
LEF1 MISSION shRNA Lentiviral Transduction Particles
lymphoid enhancer-binding factor 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-2091s21c1
Sequence:CCGGTGGTCAGCGCGAGACAATTATCTCGAGATAATTGTCTCGCGCTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-1947s21c1
Sequence:CCGGGTAGCTGAGTGCACGCTAAAGCTCGAGCTTTAGCGTGCACTCAGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-1164s21c1
Sequence:CCGGTTGGTTAACGAGTCCGAAATCCTCGAGGATTTCGGACTCGTTAACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1360s21c1
Sequence:CCGGGCGACCCGTACATGTCAAATGCTCGAGCATTTGACATGTACGGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1146s21c1
Sequence:CCGGGCCGACATCAAGTCATCTTTGCTCGAGCAAAGATGACTTGATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1398s21c1
Sequence:CCGGATCCCGAGGACATCAAATAAACTCGAGTTTATTTGATGTCCTCGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010703.3-2200s21c1
Sequence:CCGGTGGTGGTAAGAGAAGCTCCTTCTCGAGAAGGAGCTTCTCTTACCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010703.3-2260s21c1
Sequence:CCGGTCTGGAGATGGAAGCTTGTTGCTCGAGCAACAAGCTTCCATCTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010703.3-1322s21c1
Sequence:GTACCGGCAGTTACTCTGGCTACATAATCTCGAGATTATGTAGCCAGAGTAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010703.3-2213s21c1
Sequence:CCGGAGCTCCTTCCCAACGTGCAAACTCGAGTTTGCACGTTGGGAAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010703.2-2305s1c1
Sequence:CCGGCCCAAGGAACACTGACAGCAACTCGAGTTGCTGTCAGTGTTCCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-2087s1c1
Sequence:CCGGGCGAGACAATTATGGCAAGAACTCGAGTTCTTGCCATAATTGTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-1875s1c1
Sequence:CCGGCATATTAAGAAGCCTCTGAATCTCGAGATTCAGAGGCTTCTTAATATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-1133s1c1
Sequence:CCGGAGCCGACATCAAGTCATCTTTCTCGAGAAAGATGACTTGATGTCGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010703.2-1309s1c1
Sequence:CCGGCCAGTTACTCTGGCTACATAACTCGAGTTATGTAGCCAGAGTAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)