EMAIL THIS PAGE TO A FRIEND

LEFTY1

left-right determination factor 1

76 Gene Product Result for
Synonyms: LEFTB LEFTYB
UniProtKB ID: O75610, Q53H67, Q5TE94
Gene ID:
Human(10637) Summary: This gene encodes a member of the TGF-beta family of proteins. A similar secreted protein in mouse plays a role in left-right asymmetry determination of organ systems during development. Alternative processing of this protein can yield three different products. This gene is closely linked to both a related family member and a related pseudogene. [provided by RefSeq, Jul 2008]
Mouse(13590) left right determination factor 1
Rat(498299) left right determination factor 1
domestic cat(101086029) left-right determination factor 1
cow(785774) left-right determination factor 1
dog(611909) left-right determination factor 1
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020997 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020997 Rosetta Predictions human pricing
NM_001109080 Rosetta Predictions rat pricing
NM_010094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223116 predicted 1190
2 SASI_Hs01_00223117 predicted 1339
3 SASI_Hs01_00223118 predicted 1185
4 SASI_Hs01_00223121 predicted 1261
5 SASI_Hs01_00223123 predicted 1277
6 SASI_Hs01_00223124 predicted 1276
7 SASI_Hs02_00354467 predicted 1256
8 SASI_Hs02_00354468 predicted 1242
9 SASI_Hs02_00354469 predicted 238
10 SASI_Hs01_00223115 predicted 1383
11 SASI_Hs01_00223119 predicted 1102
12 SASI_Hs01_00223120 predicted 1155
13 SASI_Hs01_00223122 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244930 predicted 1346
2 SASI_Rn02_00244931 predicted 937
3 SASI_Rn02_00244932 predicted 1347
4 SASI_Rn02_00244933 predicted 942
5 SASI_Rn02_00244934 predicted 239
6 SASI_Rn02_00244935 predicted 1318
7 SASI_Rn02_00244936 predicted 881
8 SASI_Rn02_00244937 predicted 217
9 SASI_Rn02_00244938 predicted 427
10 SASI_Rn02_00244939 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170763 predicted 1199
2 SASI_Mm01_00170764 predicted 1304
3 SASI_Mm01_00170765 predicted 1375
4 SASI_Mm01_00170766 predicted 1263
5 SASI_Mm01_00170767 predicted 246
6 SASI_Mm01_00170768 predicted 1199
7 SASI_Mm01_00170769 predicted 291
8 SASI_Mm01_00170770 predicted 1380
9 SASI_Mm01_00170771 predicted 1555
10 SASI_Mm01_00170772 predicted 1411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010094
LEFTY1 MISSION shRNA Bacterial Glycerol Stock
left-right determination factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-486s1c1
Sequence:CCGGCACCATTGAATGGCTGCGCTTCTCGAGAAGCGCAGCCATTCAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-238s1c1
Sequence:CCGGGCCCTGCTACAACACAGCCATCTCGAGATGGCTGTGTTGTAGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-692s1c1
Sequence:CCGGGCTCACACAAGTTGGTTCGTTCTCGAGAACGAACCAACTTGTGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-80s1c1
Sequence:CCGGTCTGGGCACTGTCGCTGGTTACTCGAGTAACCAGCGACAGTGCCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-692s1c2
Sequence:CCGGGCTCACACAAGTTGGTTCGTTCTCGAGAACGAACCAACTTGTGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010094
LEFTY1 MISSION shRNA shRNA Plasmid DNA
left-right determination factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-486s1c1
Sequence:CCGGCACCATTGAATGGCTGCGCTTCTCGAGAAGCGCAGCCATTCAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-238s1c1
Sequence:CCGGGCCCTGCTACAACACAGCCATCTCGAGATGGCTGTGTTGTAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-692s1c1
Sequence:CCGGGCTCACACAAGTTGGTTCGTTCTCGAGAACGAACCAACTTGTGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-80s1c1
Sequence:CCGGTCTGGGCACTGTCGCTGGTTACTCGAGTAACCAGCGACAGTGCCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-692s1c2
Sequence:CCGGGCTCACACAAGTTGGTTCGTTCTCGAGAACGAACCAACTTGTGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010094
LEFTY1 MISSION shRNA Lentiviral Transduction Particles
left-right determination factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-486s1c1
Sequence:CCGGCACCATTGAATGGCTGCGCTTCTCGAGAAGCGCAGCCATTCAATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-238s1c1
Sequence:CCGGGCCCTGCTACAACACAGCCATCTCGAGATGGCTGTGTTGTAGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-692s1c1
Sequence:CCGGGCTCACACAAGTTGGTTCGTTCTCGAGAACGAACCAACTTGTGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-80s1c1
Sequence:CCGGTCTGGGCACTGTCGCTGGTTACTCGAGTAACCAGCGACAGTGCCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010094.2-692s1c2
Sequence:CCGGGCTCACACAAGTTGGTTCGTTCTCGAGAACGAACCAACTTGTGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020997
LEFTY1 MISSION shRNA Bacterial Glycerol Stock
left-right determination factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-713s1c1
Sequence:CCGGGCCCACAAGCTGGTCCGCTTTCTCGAGAAAGCGGACCAGCTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-174s1c1
Sequence:CCGGTGCAGCTCAAAGAGGTGCCCACTCGAGTGGGCACCTCTTTGAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-1099s1c1
Sequence:CCGGGCCCAACATGAGGGTGCAGAACTCGAGTTCTGCACCCTCATGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-1039s1c1
Sequence:CCGGGCTGCCCATGATCGTCAGCATCTCGAGATGCTGACGATCATGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-193s1c1
Sequence:CCGGCACCCTGGACAGGGCCGACATCTCGAGATGTCGGCCCTGTCCAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1312s21c1
Sequence:CCGGACAAGTTACCTCACCTAATTTCTCGAGAAATTAGGTGAGGTAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1458s21c1
Sequence:CCGGAGCCCAATGTGTCATTGTTTACTCGAGTAAACAATGACACATTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1281s21c1
Sequence:CCGGTCTCTAGTGAGCCCTGAATTTCTCGAGAAATTCAGGGCTCACTAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1252s21c1
Sequence:CCGGTGAACTGCTGATGGACAAATGCTCGAGCATTTGTCCATCAGCAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020997
LEFTY1 MISSION shRNA shRNA Plasmid DNA
left-right determination factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-713s1c1
Sequence:CCGGGCCCACAAGCTGGTCCGCTTTCTCGAGAAAGCGGACCAGCTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-174s1c1
Sequence:CCGGTGCAGCTCAAAGAGGTGCCCACTCGAGTGGGCACCTCTTTGAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-1099s1c1
Sequence:CCGGGCCCAACATGAGGGTGCAGAACTCGAGTTCTGCACCCTCATGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-1039s1c1
Sequence:CCGGGCTGCCCATGATCGTCAGCATCTCGAGATGCTGACGATCATGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-193s1c1
Sequence:CCGGCACCCTGGACAGGGCCGACATCTCGAGATGTCGGCCCTGTCCAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1312s21c1
Sequence:CCGGACAAGTTACCTCACCTAATTTCTCGAGAAATTAGGTGAGGTAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1458s21c1
Sequence:CCGGAGCCCAATGTGTCATTGTTTACTCGAGTAAACAATGACACATTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1281s21c1
Sequence:CCGGTCTCTAGTGAGCCCTGAATTTCTCGAGAAATTCAGGGCTCACTAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1252s21c1
Sequence:CCGGTGAACTGCTGATGGACAAATGCTCGAGCATTTGTCCATCAGCAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020997
LEFTY1 MISSION shRNA Lentiviral Transduction Particles
left-right determination factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-713s1c1
Sequence:CCGGGCCCACAAGCTGGTCCGCTTTCTCGAGAAAGCGGACCAGCTTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-174s1c1
Sequence:CCGGTGCAGCTCAAAGAGGTGCCCACTCGAGTGGGCACCTCTTTGAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-1099s1c1
Sequence:CCGGGCCCAACATGAGGGTGCAGAACTCGAGTTCTGCACCCTCATGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-1039s1c1
Sequence:CCGGGCTGCCCATGATCGTCAGCATCTCGAGATGCTGACGATCATGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020997.2-193s1c1
Sequence:CCGGCACCCTGGACAGGGCCGACATCTCGAGATGTCGGCCCTGTCCAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1312s21c1
Sequence:CCGGACAAGTTACCTCACCTAATTTCTCGAGAAATTAGGTGAGGTAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1458s21c1
Sequence:CCGGAGCCCAATGTGTCATTGTTTACTCGAGTAAACAATGACACATTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1281s21c1
Sequence:CCGGTCTCTAGTGAGCCCTGAATTTCTCGAGAAATTCAGGGCTCACTAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020997.2-1252s21c1
Sequence:CCGGTGAACTGCTGATGGACAAATGCTCGAGCATTTGTCCATCAGCAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)