EMAIL THIS PAGE TO A FRIEND

LEFTY2

left-right determination factor 2

82 Gene Product Result for
Synonyms: EBAF LEFTA LEFTYA TGFB4
Gene ID:
Human(7044) Summary: This gene encodes a member of the TGF-beta family of proteins. The encoded protein is secreted and plays a role in left-right asymmetry determination of organ systems during development. The protein may also play a role in endometrial bleeding. Mutations in this gene have been associated with left-right axis malformations, particularly in the heart and lungs. Some types of infertility have been associated with dysregulated expression of this gene in the endometrium. Alternative processing of this protein can yield three different products. This gene is closely linked to both a related family member and a related pseudogene. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Mouse(320202) left-right determination factor 2
Rat(289316) Left-right determination factor 2
sheep(101111566) left-right determination factor 2
domestic guinea pig(100736071) left-right determination factor 2
naked mole-rat(101698055) left-right determination factor 2
chicken(395529) left-right determination factor 2
dog(490387) left-right determination factor 2
cow(534018) left-right determination factor 2
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1560 Human Lefty-A ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003240 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU008491 MISSION® esiRNA esiRNA targeting mouse Lefty2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003240 Rosetta Predictions human pricing
NM_001007556 Rosetta Predictions rat pricing
NM_177099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161899 predicted 1332
2 SASI_Hs02_00335276 predicted 1258
3 SASI_Hs02_00335277 predicted 1212
4 SASI_Hs01_00161903 predicted 1371
5 SASI_Hs01_00161904 predicted 1191
6 SASI_Hs01_00161905 predicted 1220
7 SASI_Hs01_00161906 predicted 1204
8 SASI_Hs01_00161907 predicted 1245
9 SASI_Hs02_00335278 predicted 1348
10 SASI_Hs02_00335279 predicted 1422
11 SASI_Hs01_00161900 predicted 1114
12 SASI_Hs01_00161901 predicted 1163
13 SASI_Hs01_00161902 predicted 624
14 SASI_Hs01_00161908 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198653 predicted 791
2 SASI_Rn02_00198654 predicted 921
3 SASI_Rn02_00198655 predicted 844
4 SASI_Rn02_00198656 predicted 224
5 SASI_Rn02_00198657 predicted 489
6 SASI_Rn02_00198658 predicted 787
7 SASI_Rn02_00198659 predicted 838
8 SASI_Rn02_00198660 predicted 437
9 SASI_Rn02_00198661 predicted 408
10 SASI_Rn02_00198662 predicted 130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063025 predicted 1348
2 SASI_Mm01_00063026 predicted 1376
3 SASI_Mm01_00063027 predicted 1337
4 SASI_Mm01_00063028 predicted 1631
5 SASI_Mm01_00063029 predicted 1575
6 SASI_Mm02_00347093 predicted 1628
7 SASI_Mm01_00063030 predicted 1177
8 SASI_Mm01_00063031 predicted 1448
9 SASI_Mm02_00347094 predicted 1547
10 SASI_Mm01_00063033 predicted 216
11 SASI_Mm01_00063032 predicted 1559
12 SASI_Mm01_00063034 predicted 1627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003240
LEFTY2 MISSION shRNA Bacterial Glycerol Stock
left-right determination factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003240.2-1349s21c1
Sequence:CCGGCTAAGCACTTACGTGAGTAAACTCGAGTTTACTCACGTAAGTGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003240.2-1265s21c1
Sequence:CCGGAGTTACTCCATCCCAATTTAGCTCGAGCTAAATTGGGATGGAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003240.2-1179s21c1
Sequence:CCGGTAGGCGCCTGGTGTATCCATTCTCGAGAATGGATACACCAGGCGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003240.2-252s21c1
Sequence:CCGGAGGGCCCAGTATGTAGTCCTGCTCGAGCAGGACTACATACTGGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-203s1c1
Sequence:CCGGCGTACTGGACAGGGCCGACATCTCGAGATGTCGGCCCTGTCCAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-218s1c1
Sequence:CCGGCGACATGGAGAAGCTGGTCATCTCGAGATGACCAGCTTCTCCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-875s1c1
Sequence:CCGGCCAGGAGATGTACATTGACCTCTCGAGAGGTCAATGTACATCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-990s1c1
Sequence:CCGGCTGGCCTTCAATTGGCCATTTCTCGAGAAATGGCCAATTGAAGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-186s1c1
Sequence:CCGGCAGCTCAGCGAGGTGCCCGTACTCGAGTACGGGCACCTCGCTGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003240
LEFTY2 MISSION shRNA shRNA Plasmid DNA
left-right determination factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003240.2-1349s21c1
Sequence:CCGGCTAAGCACTTACGTGAGTAAACTCGAGTTTACTCACGTAAGTGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003240.2-1265s21c1
Sequence:CCGGAGTTACTCCATCCCAATTTAGCTCGAGCTAAATTGGGATGGAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003240.2-1179s21c1
Sequence:CCGGTAGGCGCCTGGTGTATCCATTCTCGAGAATGGATACACCAGGCGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003240.2-252s21c1
Sequence:CCGGAGGGCCCAGTATGTAGTCCTGCTCGAGCAGGACTACATACTGGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-203s1c1
Sequence:CCGGCGTACTGGACAGGGCCGACATCTCGAGATGTCGGCCCTGTCCAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-218s1c1
Sequence:CCGGCGACATGGAGAAGCTGGTCATCTCGAGATGACCAGCTTCTCCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-875s1c1
Sequence:CCGGCCAGGAGATGTACATTGACCTCTCGAGAGGTCAATGTACATCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-990s1c1
Sequence:CCGGCTGGCCTTCAATTGGCCATTTCTCGAGAAATGGCCAATTGAAGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-186s1c1
Sequence:CCGGCAGCTCAGCGAGGTGCCCGTACTCGAGTACGGGCACCTCGCTGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003240
LEFTY2 MISSION shRNA Lentiviral Transduction Particles
left-right determination factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003240.2-1349s21c1
Sequence:CCGGCTAAGCACTTACGTGAGTAAACTCGAGTTTACTCACGTAAGTGCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003240.2-1265s21c1
Sequence:CCGGAGTTACTCCATCCCAATTTAGCTCGAGCTAAATTGGGATGGAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003240.2-1179s21c1
Sequence:CCGGTAGGCGCCTGGTGTATCCATTCTCGAGAATGGATACACCAGGCGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003240.2-252s21c1
Sequence:CCGGAGGGCCCAGTATGTAGTCCTGCTCGAGCAGGACTACATACTGGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-203s1c1
Sequence:CCGGCGTACTGGACAGGGCCGACATCTCGAGATGTCGGCCCTGTCCAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-218s1c1
Sequence:CCGGCGACATGGAGAAGCTGGTCATCTCGAGATGACCAGCTTCTCCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-875s1c1
Sequence:CCGGCCAGGAGATGTACATTGACCTCTCGAGAGGTCAATGTACATCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-990s1c1
Sequence:CCGGCTGGCCTTCAATTGGCCATTTCTCGAGAAATGGCCAATTGAAGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003240.2-186s1c1
Sequence:CCGGCAGCTCAGCGAGGTGCCCGTACTCGAGTACGGGCACCTCGCTGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177099
LEFTY2 MISSION shRNA Bacterial Glycerol Stock
left-right determination factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-500s1c1
Sequence:CCGGCACCATTGAATGGCTGAGAGTCTCGAGACTCTCAGCCATTCAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-289s1c1
Sequence:CCGGGCAAGAGGTTCAGCCAGAATTCTCGAGAATTCTGGCTGAACCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-707s1c1
Sequence:CCGGCGCACACAAGTTGGTCCGTTTCTCGAGAAACGGACCAACTTGTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-138s1c1
Sequence:CCGGGAACAGGTCCTGAGCAGTCTACTCGAGTAGACTGCTCAGGACCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-1043s1c1
Sequence:CCGGGCCCATGATTGTCAGTGTGAACTCGAGTTCACACTGACAATCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177099
LEFTY2 MISSION shRNA shRNA Plasmid DNA
left-right determination factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-500s1c1
Sequence:CCGGCACCATTGAATGGCTGAGAGTCTCGAGACTCTCAGCCATTCAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-289s1c1
Sequence:CCGGGCAAGAGGTTCAGCCAGAATTCTCGAGAATTCTGGCTGAACCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-707s1c1
Sequence:CCGGCGCACACAAGTTGGTCCGTTTCTCGAGAAACGGACCAACTTGTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-138s1c1
Sequence:CCGGGAACAGGTCCTGAGCAGTCTACTCGAGTAGACTGCTCAGGACCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-1043s1c1
Sequence:CCGGGCCCATGATTGTCAGTGTGAACTCGAGTTCACACTGACAATCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177099
LEFTY2 MISSION shRNA Lentiviral Transduction Particles
left-right determination factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-500s1c1
Sequence:CCGGCACCATTGAATGGCTGAGAGTCTCGAGACTCTCAGCCATTCAATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-289s1c1
Sequence:CCGGGCAAGAGGTTCAGCCAGAATTCTCGAGAATTCTGGCTGAACCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-707s1c1
Sequence:CCGGCGCACACAAGTTGGTCCGTTTCTCGAGAAACGGACCAACTTGTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-138s1c1
Sequence:CCGGGAACAGGTCCTGAGCAGTCTACTCGAGTAGACTGCTCAGGACCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177099.3-1043s1c1
Sequence:CCGGGCCCATGATTGTCAGTGTGAACTCGAGTTCACACTGACAATCATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)