EMAIL THIS PAGE TO A FRIEND

LEKR1

leucine, glutamate and lysine rich 1

47 Gene Product Result for
UniProtKB ID: Q6ZMV7
Gene ID:
Mouse(624866) leucine, glutamate and lysine rich 1
Rat(361953) leucine, glutamate and lysine rich 1
chicken(425025) leucine, glutamate and lysine rich 1
dog(485729) leucine, glutamate and lysine rich 1
domestic cat(101088022) leucine, glutamate and lysine rich 1
cow(785790) leucine, glutamate and lysine rich 1
sheep(101120544) leucine, glutamate and lysine rich 1
Domestic Rabbit(100341703) leucine, glutamate and lysine rich 1
domestic guinea pig(100727530) leucine, glutamate and lysine rich 1
naked mole-rat(101712881) leucine, glutamate and lysine rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004316 Rosetta Predictions human pricing
NM_001115029 Rosetta Predictions rat pricing
NM_001037923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105067 predicted 1960
2 SASI_Hs01_00105069 predicted 1933
3 SASI_Hs01_00105070 predicted 2363
4 SASI_Hs01_00105071 predicted 1967
5 SASI_Hs01_00105072 predicted 2184
6 SASI_Hs01_00105073 predicted 2439
7 SASI_Hs01_00105074 predicted 1769
8 SASI_Hs01_00105075 predicted 2006
9 SASI_Hs01_00105076 predicted 2184
10 SASI_Hs02_00304533 predicted 1859
11 SASI_Hs01_00105068 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252463 predicted 663
2 SASI_Rn02_00252464 predicted 554
3 SASI_Rn02_00252465 predicted 519
4 SASI_Rn02_00252466 predicted 730
5 SASI_Rn02_00252467 predicted 965
6 SASI_Rn02_00252468 predicted 797
7 SASI_Rn02_00252469 predicted 556
8 SASI_Rn02_00252470 predicted 910
9 SASI_Rn02_00252471 predicted 669
10 SASI_Rn02_00252472 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035178 predicted 381
2 SASI_Mm01_00035179 predicted 329
3 SASI_Mm01_00035180 predicted 415
4 SASI_Mm01_00035181 predicted 400
5 SASI_Mm01_00035183 predicted 373
6 SASI_Mm01_00035184 predicted 252
7 SASI_Mm02_00289528 predicted 437
8 SASI_Mm01_00035186 predicted 919
9 SASI_Mm01_00035187 predicted 589
10 SASI_Mm02_00289529 predicted 649
11 SASI_Mm01_00035182 predicted 251
12 SASI_Mm01_00035185 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004316
LEKR1 MISSION shRNA Bacterial Glycerol Stock
leucine, glutamate and lysine rich 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-2254s1c1
Sequence:CCGGGCTGCAGCAGTCAGTAATCATCTCGAGATGATTACTGACTGCTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-2193s1c1
Sequence:CCGGGCTTCGTGGAAGTTTACCATTCTCGAGAATGGTAAACTTCCACGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-1945s1c1
Sequence:CCGGGAATCTCGCTTGAAGAAGGAACTCGAGTTCCTTCTTCAAGCGAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-1621s1c1
Sequence:CCGGGAGAAGATTGAAGCAGAACTTCTCGAGAAGTTCTGCTTCAATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004316.2-1057s21c1
Sequence:CCGGATGACTTGTCAACAGATATATCTCGAGATATATCTGTTGACAAGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004316.2-2306s21c1
Sequence:CCGGGGCATACCTATAGATGTATTTCTCGAGAAATACATCTATAGGTATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004316.2-990s21c1
Sequence:CCGGGAAGTTTGAATCCATTATTTCCTCGAGGAAATAATGGATTCAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004316.2-2383s21c1
Sequence:CCGGTGATAGAGTAACAGATCATTACTCGAGTAATGATCTGTTACTCTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004316
LEKR1 MISSION shRNA shRNA Plasmid DNA
leucine, glutamate and lysine rich 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-2254s1c1
Sequence:CCGGGCTGCAGCAGTCAGTAATCATCTCGAGATGATTACTGACTGCTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-2193s1c1
Sequence:CCGGGCTTCGTGGAAGTTTACCATTCTCGAGAATGGTAAACTTCCACGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-1945s1c1
Sequence:CCGGGAATCTCGCTTGAAGAAGGAACTCGAGTTCCTTCTTCAAGCGAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-1621s1c1
Sequence:CCGGGAGAAGATTGAAGCAGAACTTCTCGAGAAGTTCTGCTTCAATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004316.2-1057s21c1
Sequence:CCGGATGACTTGTCAACAGATATATCTCGAGATATATCTGTTGACAAGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004316.2-2306s21c1
Sequence:CCGGGGCATACCTATAGATGTATTTCTCGAGAAATACATCTATAGGTATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004316.2-990s21c1
Sequence:CCGGGAAGTTTGAATCCATTATTTCCTCGAGGAAATAATGGATTCAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004316.2-2383s21c1
Sequence:CCGGTGATAGAGTAACAGATCATTACTCGAGTAATGATCTGTTACTCTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004316
LEKR1 MISSION shRNA Lentiviral Transduction Particles
leucine, glutamate and lysine rich 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-2254s1c1
Sequence:CCGGGCTGCAGCAGTCAGTAATCATCTCGAGATGATTACTGACTGCTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-2193s1c1
Sequence:CCGGGCTTCGTGGAAGTTTACCATTCTCGAGAATGGTAAACTTCCACGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-1945s1c1
Sequence:CCGGGAATCTCGCTTGAAGAAGGAACTCGAGTTCCTTCTTCAAGCGAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004316.1-1621s1c1
Sequence:CCGGGAGAAGATTGAAGCAGAACTTCTCGAGAAGTTCTGCTTCAATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004316.2-1057s21c1
Sequence:CCGGATGACTTGTCAACAGATATATCTCGAGATATATCTGTTGACAAGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004316.2-2306s21c1
Sequence:CCGGGGCATACCTATAGATGTATTTCTCGAGAAATACATCTATAGGTATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004316.2-990s21c1
Sequence:CCGGGAAGTTTGAATCCATTATTTCCTCGAGGAAATAATGGATTCAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004316.2-2383s21c1
Sequence:CCGGTGATAGAGTAACAGATCATTACTCGAGTAATGATCTGTTACTCTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037923
LEKR1 MISSION shRNA Bacterial Glycerol Stock
leucine, glutamate and lysine rich 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-413s21c1
Sequence:CCGGTTCAAGGCAAACAGTAGATTTCTCGAGAAATCTACTGTTTGCCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037923.3-1285s21c1
Sequence:CCGGTACTCTACCAAGTAGCTATATCTCGAGATATAGCTACTTGGTAGAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-196s21c1
Sequence:CCGGCTGTGGCGTCAGCTATCTAATCTCGAGATTAGATAGCTGACGCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-335s21c1
Sequence:CCGGCAGGAGTTTGAACAGTATAAACTCGAGTTTATACTGTTCAAACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-389s21c1
Sequence:CCGGTATGTTTCCTGTCTCTTATTTCTCGAGAAATAAGAGACAGGAAACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037923
LEKR1 MISSION shRNA shRNA Plasmid DNA
leucine, glutamate and lysine rich 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-413s21c1
Sequence:CCGGTTCAAGGCAAACAGTAGATTTCTCGAGAAATCTACTGTTTGCCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037923.3-1285s21c1
Sequence:CCGGTACTCTACCAAGTAGCTATATCTCGAGATATAGCTACTTGGTAGAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-196s21c1
Sequence:CCGGCTGTGGCGTCAGCTATCTAATCTCGAGATTAGATAGCTGACGCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-335s21c1
Sequence:CCGGCAGGAGTTTGAACAGTATAAACTCGAGTTTATACTGTTCAAACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-389s21c1
Sequence:CCGGTATGTTTCCTGTCTCTTATTTCTCGAGAAATAAGAGACAGGAAACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037923
LEKR1 MISSION shRNA Lentiviral Transduction Particles
leucine, glutamate and lysine rich 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-413s21c1
Sequence:CCGGTTCAAGGCAAACAGTAGATTTCTCGAGAAATCTACTGTTTGCCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037923.3-1285s21c1
Sequence:CCGGTACTCTACCAAGTAGCTATATCTCGAGATATAGCTACTTGGTAGAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-196s21c1
Sequence:CCGGCTGTGGCGTCAGCTATCTAATCTCGAGATTAGATAGCTGACGCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-335s21c1
Sequence:CCGGCAGGAGTTTGAACAGTATAAACTCGAGTTTATACTGTTCAAACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037923.3-389s21c1
Sequence:CCGGTATGTTTCCTGTCTCTTATTTCTCGAGAAATAAGAGACAGGAAACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)