EMAIL THIS PAGE TO A FRIEND

LELP1

late cornified envelope-like proline-rich 1

24 Gene Product Result for
UniProtKB ID: Q5T871, A1L4E1
Gene ID:
Mouse(69332) late cornified envelope-like proline-rich 1
domestic guinea pig(100733843) late cornified envelope-like proline-rich 1
sheep(101102856) late cornified envelope-like proline-rich 1
domestic cat(101088602) late cornified envelope-like proline-rich 1
cow(767996) late cornified envelope-like proline-rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010857 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160751 MISSION® esiRNA esiRNA human LELP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010857 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052619 predicted 203
2 SASI_Hs01_00052620 predicted 217
3 SASI_Hs01_00052621 predicted 219
4 SASI_Hs01_00052622 predicted 224
5 SASI_Hs01_00052623 predicted 216
6 SASI_Hs01_00052624 predicted 203
7 SASI_Hs01_00052625 predicted 211
8 SASI_Hs01_00052626 predicted 333
9 SASI_Hs01_00052627 predicted 476
10 SASI_Hs01_00052628 predicted 150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010857
LELP1 MISSION shRNA Bacterial Glycerol Stock
late cornified envelope-like proline-rich 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-197s21c1
Sequence:CCGGCAAATGCCAGCCCAGCTGTTTCTCGAGAAACAGCTGGGCTGGCATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-335s21c1
Sequence:CCGGCAAGCCCTGTCCTCCTAAATGCTCGAGCATTTAGGAGGACAGGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010857.1-206s1c1
Sequence:CCGGGCCCAGCTGTTTAAAGAAGCTCTCGAGAGCTTCTTTAAACAGCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-144s21c1
Sequence:CCGGCCCAAGACTGAGCCCAAGAACCTCGAGGTTCTTGGGCTCAGTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-166s21c1
Sequence:CCGGGCGATCCCAAGTGTGAACAAACTCGAGTTTGTTCACACTTGGGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010857
LELP1 MISSION shRNA shRNA Plasmid DNA
late cornified envelope-like proline-rich 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-197s21c1
Sequence:CCGGCAAATGCCAGCCCAGCTGTTTCTCGAGAAACAGCTGGGCTGGCATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-335s21c1
Sequence:CCGGCAAGCCCTGTCCTCCTAAATGCTCGAGCATTTAGGAGGACAGGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010857.1-206s1c1
Sequence:CCGGGCCCAGCTGTTTAAAGAAGCTCTCGAGAGCTTCTTTAAACAGCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-144s21c1
Sequence:CCGGCCCAAGACTGAGCCCAAGAACCTCGAGGTTCTTGGGCTCAGTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-166s21c1
Sequence:CCGGGCGATCCCAAGTGTGAACAAACTCGAGTTTGTTCACACTTGGGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010857
LELP1 MISSION shRNA Lentiviral Transduction Particles
late cornified envelope-like proline-rich 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-197s21c1
Sequence:CCGGCAAATGCCAGCCCAGCTGTTTCTCGAGAAACAGCTGGGCTGGCATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-335s21c1
Sequence:CCGGCAAGCCCTGTCCTCCTAAATGCTCGAGCATTTAGGAGGACAGGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010857.1-206s1c1
Sequence:CCGGGCCCAGCTGTTTAAAGAAGCTCTCGAGAGCTTCTTTAAACAGCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-144s21c1
Sequence:CCGGCCCAAGACTGAGCCCAAGAACCTCGAGGTTCTTGGGCTCAGTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010857.1-166s21c1
Sequence:CCGGGCGATCCCAAGTGTGAACAAACTCGAGTTTGTTCACACTTGGGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)