EMAIL THIS PAGE TO A FRIEND

LEMD1

LEM domain containing 1

41 Gene Product Result for
Synonyms: CT50 LEMP-1
Gene ID:
Mouse(213409) LEM domain containing 1
cow(767969) LEM domain containing 1
domestic cat(101085265) LEM domain containing 1
dog(100685521) LEM domain containing 1
sheep(101110608) LEM domain containing 1
domestic guinea pig(101788110) LEM domain containing 1
naked mole-rat(101710040) LEM domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001552 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122151 MISSION® esiRNA esiRNA human LEMD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001552 Rosetta Predictions human pricing
NM_001033250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057123 predicted 493
2 SASI_Hs01_00057124 predicted 299
3 SASI_Hs01_00057125 predicted 344
4 SASI_Hs01_00057126 predicted 422
5 SASI_Hs01_00057127 predicted 407
6 SASI_Hs01_00057128 predicted 266
7 SASI_Hs01_00057129 predicted 320
8 SASI_Hs01_00057130 predicted 463
9 SASI_Hs01_00057131 predicted 334
10 SASI_Hs01_00057132 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288407 predicted 733
2 SASI_Mm02_00288408 predicted 414
3 SASI_Mm02_00288409 predicted 771
4 SASI_Mm02_00288410 predicted 798
5 SASI_Mm02_00288411 predicted 322
6 SASI_Mm02_00288412 predicted 513
7 SASI_Mm02_00288413 predicted 919
8 SASI_Mm02_00288414 predicted 279
9 SASI_Mm02_00288415 predicted 229
10 SASI_Mm02_00288416 predicted 252
11 SASI_Mm01_00161980 predicted 462
12 SASI_Mm01_00161981 predicted 326
13 SASI_Mm01_00161982 predicted 468
14 SASI_Mm01_00161983 predicted 473
15 SASI_Mm01_00161984 predicted 462
16 SASI_Mm01_00161985 predicted 320
17 SASI_Mm01_00161986 predicted 274
18 SASI_Mm01_00161987 predicted 290
19 SASI_Mm01_00161988 predicted 302
20 SASI_Mm01_00161989 predicted 330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033250
LEMD1 MISSION shRNA Bacterial Glycerol Stock
LEM domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-354s21c1
Sequence:CCGGAGACTACTCTCGATGCAACAACTCGAGTTGTTGCATCGAGAGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033250.3-1814s21c1
Sequence:CCGGGCCCTATACAAAGGTACAATACTCGAGTATTGTACCTTTGTATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-287s21c1
Sequence:CCGGAGCGATGACAGTGAAGGTATGCTCGAGCATACCTTCACTGTCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-128s21c1
Sequence:CCGGGAGTTGCACAAGCATCTTATGCTCGAGCATAAGATGCTTGTGCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-173s21c1
Sequence:CCGGATACTACCTTCCACCAGAAAGCTCGAGCTTTCTGGTGGAAGGTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033250
LEMD1 MISSION shRNA shRNA Plasmid DNA
LEM domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-354s21c1
Sequence:CCGGAGACTACTCTCGATGCAACAACTCGAGTTGTTGCATCGAGAGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033250.3-1814s21c1
Sequence:CCGGGCCCTATACAAAGGTACAATACTCGAGTATTGTACCTTTGTATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-287s21c1
Sequence:CCGGAGCGATGACAGTGAAGGTATGCTCGAGCATACCTTCACTGTCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-128s21c1
Sequence:CCGGGAGTTGCACAAGCATCTTATGCTCGAGCATAAGATGCTTGTGCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-173s21c1
Sequence:CCGGATACTACCTTCCACCAGAAAGCTCGAGCTTTCTGGTGGAAGGTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033250
LEMD1 MISSION shRNA Lentiviral Transduction Particles
LEM domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-354s21c1
Sequence:CCGGAGACTACTCTCGATGCAACAACTCGAGTTGTTGCATCGAGAGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033250.3-1814s21c1
Sequence:CCGGGCCCTATACAAAGGTACAATACTCGAGTATTGTACCTTTGTATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-287s21c1
Sequence:CCGGAGCGATGACAGTGAAGGTATGCTCGAGCATACCTTCACTGTCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-128s21c1
Sequence:CCGGGAGTTGCACAAGCATCTTATGCTCGAGCATAAGATGCTTGTGCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033250.3-173s21c1
Sequence:CCGGATACTACCTTCCACCAGAAAGCTCGAGCTTTCTGGTGGAAGGTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001552
LEMD1 MISSION shRNA Bacterial Glycerol Stock
LEM domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000451451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001552.3-491s21c1
Sequence:CCGGGTCGCTGTTTGGTTAAGTAATCTCGAGATTACTTAACCAAACAGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001552.2-144s1c1
Sequence:CCGGCCAACTTGAGAAGCTTGGATTCTCGAGAATCCAAGCTTCTCAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001552.2-473s1c1
Sequence:CCGGCCAGAATCACATATGGGACTACTCGAGTAGTCCCATATGTGATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001552.2-474s1c1
Sequence:CCGGCAGAATCACATATGGGACTATCTCGAGATAGTCCCATATGTGATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001552.3-215s21c1
Sequence:CCGGTAGTACAGTTGTTGGTCTCACCTCGAGGTGAGACCAACAACTGTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001552.2-302s1c1
Sequence:CCGGGCGAAGAGCTTAATATCATTTCTCGAGAAATGATATTAAGCTCTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001552
LEMD1 MISSION shRNA shRNA Plasmid DNA
LEM domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000451451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001552.3-491s21c1
Sequence:CCGGGTCGCTGTTTGGTTAAGTAATCTCGAGATTACTTAACCAAACAGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001552.2-144s1c1
Sequence:CCGGCCAACTTGAGAAGCTTGGATTCTCGAGAATCCAAGCTTCTCAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001552.2-473s1c1
Sequence:CCGGCCAGAATCACATATGGGACTACTCGAGTAGTCCCATATGTGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001552.2-474s1c1
Sequence:CCGGCAGAATCACATATGGGACTATCTCGAGATAGTCCCATATGTGATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001552.3-215s21c1
Sequence:CCGGTAGTACAGTTGTTGGTCTCACCTCGAGGTGAGACCAACAACTGTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001552.2-302s1c1
Sequence:CCGGGCGAAGAGCTTAATATCATTTCTCGAGAAATGATATTAAGCTCTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001552
LEMD1 MISSION shRNA Lentiviral Transduction Particles
LEM domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000451451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001552.3-491s21c1
Sequence:CCGGGTCGCTGTTTGGTTAAGTAATCTCGAGATTACTTAACCAAACAGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001552.2-144s1c1
Sequence:CCGGCCAACTTGAGAAGCTTGGATTCTCGAGAATCCAAGCTTCTCAAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001552.2-473s1c1
Sequence:CCGGCCAGAATCACATATGGGACTACTCGAGTAGTCCCATATGTGATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001552.2-474s1c1
Sequence:CCGGCAGAATCACATATGGGACTATCTCGAGATAGTCCCATATGTGATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001552.3-215s21c1
Sequence:CCGGTAGTACAGTTGTTGGTCTCACCTCGAGGTGAGACCAACAACTGTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001552.2-302s1c1
Sequence:CCGGGCGAAGAGCTTAATATCATTTCTCGAGAAATGATATTAAGCTCTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)