EMAIL THIS PAGE TO A FRIEND

LEMD2

LEM domain containing 2

50 Gene Product Result for
Synonyms: NET25 dJ482C21.1
UniProtKB ID: Q8NC56, B4DVH5, E7EVT2, Q5T972, Q5T974
Gene ID:
Mouse(224640) LEM domain containing 2
Rat(361807) LEM domain containing 2
chicken(419907) LEM domain containing 2
domestic cat(101094178) LEM domain containing 2
cow(518023) LEM domain containing 2
dog(607981) LEM domain containing 2
domestic guinea pig(100728067) LEM domain containing 2
naked mole-rat(101706009) LEM domain containing 2
sheep(101119168) LEM domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017340 Anti-LEMD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103641 Anti-LEMD2 antibody produced in rabbit affinity isolated antibody horse, mouse, human, rabbit, dog, guinea pig, rat, bovine
western blot pricing
SAB2103642 Anti-LEMD2 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rat, human, horse, dog, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181336 Rosetta Predictions human pricing
NM_001039032 Rosetta Predictions rat pricing
NM_146075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369994 predicted 1629
2 SASI_Hs01_00111558 predicted 1030
3 SASI_Hs02_00369995 predicted 1619
4 SASI_Hs01_00111559 predicted 1664
5 SASI_Hs01_00111560 predicted 1297
6 SASI_Hs01_00111562 predicted 1454
7 SASI_Hs01_00111565 predicted 1304
8 SASI_Hs01_00111566 predicted 907
9 SASI_Hs01_00111567 predicted 967
10 SASI_Hs02_00369996 predicted 1131
11 SASI_Hs01_00111561 predicted 1723
12 SASI_Hs01_00111563 predicted 2012
13 SASI_Hs01_00111564 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054643 predicted 668
2 SASI_Rn01_00054645 predicted 1542
3 SASI_Rn02_00204784 predicted 1109
4 SASI_Rn01_00054646 predicted 489
5 SASI_Rn01_00054647 predicted 935
6 SASI_Rn01_00054648 predicted 767
7 SASI_Rn01_00054649 predicted 1042
8 SASI_Rn01_00054650 predicted 1165
9 SASI_Rn01_00054651 predicted 733
10 SASI_Rn02_00204785 predicted 225
11 SASI_Rn01_00054642 predicted 1212
12 SASI_Rn01_00054644 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033068 predicted 991
2 SASI_Mm01_00033070 predicted 1417
3 SASI_Mm02_00341706 predicted 1498
4 SASI_Mm01_00033071 predicted 1262
5 SASI_Mm01_00033072 predicted 962
6 SASI_Mm02_00341707 predicted 464
7 SASI_Mm01_00033073 predicted 1659
8 SASI_Mm01_00033074 predicted 1431
9 SASI_Mm01_00033075 predicted 1127
10 SASI_Mm01_00033076 predicted 1600
11 SASI_Mm01_00033069 predicted 814
12 SASI_Mm01_00033077 predicted 920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181336
VALIDATED
LEMD2 MISSION shRNA Bacterial Glycerol Stock
LEM domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181336.3-1636s21c1
Sequence:CCGGAGTCTCGTCCTGACACGATTCCTCGAGGAATCGTGTCAGGACGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181336.3-1506s21c1
Sequence:CCGGTCTCTGACTCAGAGCGATAAGCTCGAGCTTATCGCTCTGAGTCAGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181336.3-902s21c1
Sequence:CCGGAGCAAATGCATTCCTGTTATGCTCGAGCATAACAGGAATGCATTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181336.2-819s1c1
Sequence:CCGGGCTGCATGAACTCTACAATTTCTCGAGAAATTGTAGAGTTCATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181336.2-916s1c1
Sequence:CCGGGCCCAAGAATATATAGCCAATCTCGAGATTGGCTATATATTCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181336.3-1010s21c1
Sequence:CCGGGACGTGGGCATCTGGTTGAAACTCGAGTTTCAACCAGATGCCCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181336.2-865s1c1
Sequence:CCGGGAGTGTGGAAATCCAGAGAATCTCGAGATTCTCTGGATTTCCACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181336.2-2725s1c1
Sequence:CCGGCCCTCATTTGAGCAATACTCTCTCGAGAGAGTATTGCTCAAATGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181336.2-1248s1c1
Sequence:CCGGGAAGAAGATTATAGACGTGGTCTCGAGACCACGTCTATAATCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181336.2-978s1c1
Sequence:CCGGCTGGATACTGAGCAGTAACAACTCGAGTTGTTACTGCTCAGTATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181336.2-1207s1c1
Sequence:CCGGCGAAAGTTAGAAGAGGAGGAACTCGAGTTCCTCCTCTTCTAACTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181336
VALIDATED
LEMD2 MISSION shRNA shRNA Plasmid DNA
LEM domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181336.3-1636s21c1
Sequence:CCGGAGTCTCGTCCTGACACGATTCCTCGAGGAATCGTGTCAGGACGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181336.3-1506s21c1
Sequence:CCGGTCTCTGACTCAGAGCGATAAGCTCGAGCTTATCGCTCTGAGTCAGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181336.3-902s21c1
Sequence:CCGGAGCAAATGCATTCCTGTTATGCTCGAGCATAACAGGAATGCATTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181336.2-819s1c1
Sequence:CCGGGCTGCATGAACTCTACAATTTCTCGAGAAATTGTAGAGTTCATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181336.2-916s1c1
Sequence:CCGGGCCCAAGAATATATAGCCAATCTCGAGATTGGCTATATATTCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181336.3-1010s21c1
Sequence:CCGGGACGTGGGCATCTGGTTGAAACTCGAGTTTCAACCAGATGCCCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181336.2-865s1c1
Sequence:CCGGGAGTGTGGAAATCCAGAGAATCTCGAGATTCTCTGGATTTCCACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181336.2-2725s1c1
Sequence:CCGGCCCTCATTTGAGCAATACTCTCTCGAGAGAGTATTGCTCAAATGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181336.2-1248s1c1
Sequence:CCGGGAAGAAGATTATAGACGTGGTCTCGAGACCACGTCTATAATCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181336.2-978s1c1
Sequence:CCGGCTGGATACTGAGCAGTAACAACTCGAGTTGTTACTGCTCAGTATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181336.2-1207s1c1
Sequence:CCGGCGAAAGTTAGAAGAGGAGGAACTCGAGTTCCTCCTCTTCTAACTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181336
VALIDATED
LEMD2 MISSION shRNA Lentiviral Transduction Particles
LEM domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181336.3-1636s21c1
Sequence:CCGGAGTCTCGTCCTGACACGATTCCTCGAGGAATCGTGTCAGGACGAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181336.3-1506s21c1
Sequence:CCGGTCTCTGACTCAGAGCGATAAGCTCGAGCTTATCGCTCTGAGTCAGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181336.3-902s21c1
Sequence:CCGGAGCAAATGCATTCCTGTTATGCTCGAGCATAACAGGAATGCATTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181336.2-819s1c1
Sequence:CCGGGCTGCATGAACTCTACAATTTCTCGAGAAATTGTAGAGTTCATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181336.2-916s1c1
Sequence:CCGGGCCCAAGAATATATAGCCAATCTCGAGATTGGCTATATATTCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181336.3-1010s21c1
Sequence:CCGGGACGTGGGCATCTGGTTGAAACTCGAGTTTCAACCAGATGCCCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181336.2-865s1c1
Sequence:CCGGGAGTGTGGAAATCCAGAGAATCTCGAGATTCTCTGGATTTCCACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181336.2-2725s1c1
Sequence:CCGGCCCTCATTTGAGCAATACTCTCTCGAGAGAGTATTGCTCAAATGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181336.2-1248s1c1
Sequence:CCGGGAAGAAGATTATAGACGTGGTCTCGAGACCACGTCTATAATCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181336.2-978s1c1
Sequence:CCGGCTGGATACTGAGCAGTAACAACTCGAGTTGTTACTGCTCAGTATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181336.2-1207s1c1
Sequence:CCGGCGAAAGTTAGAAGAGGAGGAACTCGAGTTCCTCCTCTTCTAACTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146075
VALIDATED
LEMD2 MISSION shRNA Bacterial Glycerol Stock
LEM domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-860s21c1
Sequence:CCGGGCTGCACGAACTGTACAACTTCTCGAGAAGTTGTACAGTTCGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146075.1-826s1c1
Sequence:CCGGGATGGACTAAGCCTTCCTCTTCTCGAGAAGAGGAAGGCTTAGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146075.1-587s1c1
Sequence:CCGGGTATGAGATGGTGAAGAAGATCTCGAGATCTTCTTCACCATCTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146075.1-612s1c1
Sequence:CCGGGATGTGGTTCAGGACCACTATCTCGAGATAGTGGTCCTGAACCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146075.1-170s1c1
Sequence:CCGGGCTGCACGAACTGTACAACTTCTCGAGAAGTTGTACAGTTCGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-1277s21c1
Sequence:CCGGGTATGAGATGGTGAAGAAGATCTCGAGATCTTCTTCACCATCTCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146075.1-267s1c1
Sequence:CCGGGCGCAGGAGTACATAGCTAATCTCGAGATTAGCTATGTACTCCTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-1302s21c1
Sequence:CCGGGATGTGGTTCAGGACCACTATCTCGAGATAGTGGTCCTGAACCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-1516s21c1
Sequence:CCGGGATGGACTAAGCCTTCCTCTTCTCGAGAAGAGGAAGGCTTAGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146075
VALIDATED
LEMD2 MISSION shRNA shRNA Plasmid DNA
LEM domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-860s21c1
Sequence:CCGGGCTGCACGAACTGTACAACTTCTCGAGAAGTTGTACAGTTCGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146075.1-826s1c1
Sequence:CCGGGATGGACTAAGCCTTCCTCTTCTCGAGAAGAGGAAGGCTTAGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146075.1-587s1c1
Sequence:CCGGGTATGAGATGGTGAAGAAGATCTCGAGATCTTCTTCACCATCTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146075.1-612s1c1
Sequence:CCGGGATGTGGTTCAGGACCACTATCTCGAGATAGTGGTCCTGAACCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146075.1-170s1c1
Sequence:CCGGGCTGCACGAACTGTACAACTTCTCGAGAAGTTGTACAGTTCGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-1277s21c1
Sequence:CCGGGTATGAGATGGTGAAGAAGATCTCGAGATCTTCTTCACCATCTCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146075.1-267s1c1
Sequence:CCGGGCGCAGGAGTACATAGCTAATCTCGAGATTAGCTATGTACTCCTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-1302s21c1
Sequence:CCGGGATGTGGTTCAGGACCACTATCTCGAGATAGTGGTCCTGAACCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-1516s21c1
Sequence:CCGGGATGGACTAAGCCTTCCTCTTCTCGAGAAGAGGAAGGCTTAGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146075
VALIDATED
LEMD2 MISSION shRNA Lentiviral Transduction Particles
LEM domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-860s21c1
Sequence:CCGGGCTGCACGAACTGTACAACTTCTCGAGAAGTTGTACAGTTCGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146075.1-826s1c1
Sequence:CCGGGATGGACTAAGCCTTCCTCTTCTCGAGAAGAGGAAGGCTTAGTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146075.1-587s1c1
Sequence:CCGGGTATGAGATGGTGAAGAAGATCTCGAGATCTTCTTCACCATCTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146075.1-612s1c1
Sequence:CCGGGATGTGGTTCAGGACCACTATCTCGAGATAGTGGTCCTGAACCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146075.1-170s1c1
Sequence:CCGGGCTGCACGAACTGTACAACTTCTCGAGAAGTTGTACAGTTCGTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-1277s21c1
Sequence:CCGGGTATGAGATGGTGAAGAAGATCTCGAGATCTTCTTCACCATCTCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146075.1-267s1c1
Sequence:CCGGGCGCAGGAGTACATAGCTAATCTCGAGATTAGCTATGTACTCCTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-1302s21c1
Sequence:CCGGGATGTGGTTCAGGACCACTATCTCGAGATAGTGGTCCTGAACCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146075.2-1516s21c1
Sequence:CCGGGATGGACTAAGCCTTCCTCTTCTCGAGAAGAGGAAGGCTTAGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)