EMAIL THIS PAGE TO A FRIEND

LEMD3

LEM domain containing 3

183 Gene Product Result for
Synonyms: MAN1
UniProtKB ID: Q9Y2U8, Q9NT47, Q9NYA5
Gene ID:
Human(23592) Summary: This locus encodes a LEM domain-containing protein. The encoded protein functions to antagonize transforming growth factor-beta signaling at the inner nuclear membrane. Two transcript variants encoding different isoforms have been found for this gene. Mutations in this gene have been associated with osteopoikilosis, Buschke-Ollendorff syndrome and melorheostosis.[provided by RefSeq, Nov 2009]
Mouse(380664) LEM domain containing 3
Rat(680066) LEM domain containing 3
sheep(101116043) LEM domain containing 3
Domestic Rabbit(100346960) LEM domain containing 3
domestic guinea pig(100730293) LEM domain containing 3
naked mole-rat(101707217) LEM domain containing 3
Zebrafish(558474) LEM domain containing 3
cow(530659) LEM domain containing 3
domestic cat(101092198) LEM domain containing 3
dog(608380) LEM domain containing 3
chicken(417832) LEM domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014319 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014319 Rosetta Predictions human pricing
XM_001055542 Rosetta Predictions rat pricing
NM_001081193 Rosetta Predictions mouse pricing
XM_354566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183430 predicted 2350
2 SASI_Hs02_00345421 predicted 2713
3 SASI_Hs01_00183431 predicted 1910
4 SASI_Hs01_00183433 predicted 1259
5 SASI_Hs01_00183435 predicted 1926
6 SASI_Hs01_00183437 predicted 2299
7 SASI_Hs02_00345422 predicted 2415
8 SASI_Hs01_00183439 predicted 2529
9 SASI_Hs02_00345423 predicted 1271
10 SASI_Hs02_00345424 predicted 1122
11 SASI_Hs01_00183432 predicted 1908
12 SASI_Hs01_00183434 predicted 1580
13 SASI_Hs01_00183436 predicted 1725
14 SASI_Hs01_00183438 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279954 predicted 1673
2 SASI_Rn02_00279955 predicted 2344
3 SASI_Rn02_00279956 predicted 2465
4 SASI_Rn02_00279957 predicted 2448
5 SASI_Rn02_00279958 predicted 2344
6 SASI_Rn02_00279959 predicted 1579
7 SASI_Rn02_00279960 predicted 1411
8 SASI_Rn02_00279961 predicted 1439
9 SASI_Rn02_00279962 predicted 2304
10 SASI_Rn02_00279963 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296101 predicted 2480
2 SASI_Mm02_00296102 predicted 1303
3 SASI_Mm02_00296103 predicted 2182
4 SASI_Mm02_00296104 predicted 2725
5 SASI_Mm02_00296105 predicted 2277
6 SASI_Mm02_00296106 predicted 2544
7 SASI_Mm02_00296107 predicted 2325
8 SASI_Mm02_00296108 predicted 2085
9 SASI_Mm02_00296109 predicted 2130
10 SASI_Mm02_00296110 predicted 2405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219419 predicted 2488
2 SASI_Mm01_00219420 predicted 1309
3 SASI_Mm01_00219421 predicted 2557
4 SASI_Mm01_00219422 predicted 1793
5 SASI_Mm01_00219423 predicted 1435
6 SASI_Mm01_00219424 predicted 2329
7 SASI_Mm01_00219425 predicted 1622
8 SASI_Mm01_00219426 predicted 2141
9 SASI_Mm01_00219427 predicted 2408
10 SASI_Mm01_00219428 predicted 2306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014319
VALIDATED
LEMD3 MISSION shRNA Bacterial Glycerol Stock
LEM domain containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000185454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_014319.3-4253s1c1
Sequence:CCGGGCACCTTGTTTATGAAGAATACTCGAGTATTCTTCATAAACAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014319.3-2714s1c1
Sequence:CCGGGCCTAACCAATTCTCAAGGAACTCGAGTTCCTTGAGAATTGGTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014319.3-3786s1c1
Sequence:CCGGCCTCTGTTATATGTCAAGTTTCTCGAGAAACTTGACATATAACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014319.3-3785s1c1
Sequence:CCGGGCCTCTGTTATATGTCAAGTTCTCGAGAACTTGACATATAACAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014319.3-3617s1c1
Sequence:CCGGCCAGTTGTAATAGAGTCAAATCTCGAGATTTGACTCTATTACAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014319.3-1065s21c1
Sequence:CCGGCGTTCCTAGATACCGTGTTAACTCGAGTTAACACGGTATCTAGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014319.3-2197s21c1
Sequence:CCGGCGCACGGAAACACGAAGAATACTCGAGTATTCTTCGTGTTTCCGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014319.3-3083s21c1
Sequence:CCGGCTTCTTGTAGTCCCATAATTTCTCGAGAAATTATGGGACTACAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014319.3-2358s21c1
Sequence:CCGGGTGTCTAAAGATTCGGAATATCTCGAGATATTCCGAATCTTTAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014319.3-1678s21c1
Sequence:CCGGCAAGAGGCAGCTGCGTATTTACTCGAGTAAATACGCAGCTGCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014319
VALIDATED
LEMD3 MISSION shRNA shRNA Plasmid DNA
LEM domain containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000185454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_014319.3-4253s1c1
Sequence:CCGGGCACCTTGTTTATGAAGAATACTCGAGTATTCTTCATAAACAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014319.3-2714s1c1
Sequence:CCGGGCCTAACCAATTCTCAAGGAACTCGAGTTCCTTGAGAATTGGTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014319.3-3786s1c1
Sequence:CCGGCCTCTGTTATATGTCAAGTTTCTCGAGAAACTTGACATATAACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014319.3-3785s1c1
Sequence:CCGGGCCTCTGTTATATGTCAAGTTCTCGAGAACTTGACATATAACAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014319.3-3617s1c1
Sequence:CCGGCCAGTTGTAATAGAGTCAAATCTCGAGATTTGACTCTATTACAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014319.3-1065s21c1
Sequence:CCGGCGTTCCTAGATACCGTGTTAACTCGAGTTAACACGGTATCTAGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014319.3-2197s21c1
Sequence:CCGGCGCACGGAAACACGAAGAATACTCGAGTATTCTTCGTGTTTCCGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014319.3-3083s21c1
Sequence:CCGGCTTCTTGTAGTCCCATAATTTCTCGAGAAATTATGGGACTACAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014319.3-2358s21c1
Sequence:CCGGGTGTCTAAAGATTCGGAATATCTCGAGATATTCCGAATCTTTAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014319.3-1678s21c1
Sequence:CCGGCAAGAGGCAGCTGCGTATTTACTCGAGTAAATACGCAGCTGCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014319
VALIDATED
LEMD3 MISSION shRNA Lentiviral Transduction Particles
LEM domain containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000185454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_014319.3-4253s1c1
Sequence:CCGGGCACCTTGTTTATGAAGAATACTCGAGTATTCTTCATAAACAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014319.3-2714s1c1
Sequence:CCGGGCCTAACCAATTCTCAAGGAACTCGAGTTCCTTGAGAATTGGTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014319.3-3786s1c1
Sequence:CCGGCCTCTGTTATATGTCAAGTTTCTCGAGAAACTTGACATATAACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014319.3-3785s1c1
Sequence:CCGGGCCTCTGTTATATGTCAAGTTCTCGAGAACTTGACATATAACAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014319.3-3617s1c1
Sequence:CCGGCCAGTTGTAATAGAGTCAAATCTCGAGATTTGACTCTATTACAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014319.3-1065s21c1
Sequence:CCGGCGTTCCTAGATACCGTGTTAACTCGAGTTAACACGGTATCTAGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014319.3-2197s21c1
Sequence:CCGGCGCACGGAAACACGAAGAATACTCGAGTATTCTTCGTGTTTCCGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014319.3-3083s21c1
Sequence:CCGGCTTCTTGTAGTCCCATAATTTCTCGAGAAATTATGGGACTACAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014319.3-2358s21c1
Sequence:CCGGGTGTCTAAAGATTCGGAATATCTCGAGATATTCCGAATCTTTAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014319.3-1678s21c1
Sequence:CCGGCAAGAGGCAGCTGCGTATTTACTCGAGTAAATACGCAGCTGCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081193
VALIDATED
LEMD3 MISSION shRNA Bacterial Glycerol Stock
LEM domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081193.2-2724s21c1
Sequence:CCGGTGCGGACTGGCCTAGCTAATTCTCGAGAATTAGCTAGGCCAGTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081193.2-1912s21c1
Sequence:CCGGTACTGTGACCCATAGGTTATTCTCGAGAATAACCTATGGGTCACAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081193.2-3967s21c1
Sequence:CCGGATAGTTACTGATCAAGGTTTACTCGAGTAAACCTTGATCAGTAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081193.2-1531s21c1
Sequence:CCGGCGAGGACGGAGGACTCATAAACTCGAGTTTATGAGTCCTCCGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081193.2-2436s21c1
Sequence:CCGGTGGCGATCCAAGAAGCGATTTCTCGAGAAATCGCTTCTTGGATCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081193
VALIDATED
LEMD3 MISSION shRNA shRNA Plasmid DNA
LEM domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081193.2-2724s21c1
Sequence:CCGGTGCGGACTGGCCTAGCTAATTCTCGAGAATTAGCTAGGCCAGTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081193.2-1912s21c1
Sequence:CCGGTACTGTGACCCATAGGTTATTCTCGAGAATAACCTATGGGTCACAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081193.2-3967s21c1
Sequence:CCGGATAGTTACTGATCAAGGTTTACTCGAGTAAACCTTGATCAGTAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081193.2-1531s21c1
Sequence:CCGGCGAGGACGGAGGACTCATAAACTCGAGTTTATGAGTCCTCCGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081193.2-2436s21c1
Sequence:CCGGTGGCGATCCAAGAAGCGATTTCTCGAGAAATCGCTTCTTGGATCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081193
VALIDATED
LEMD3 MISSION shRNA Lentiviral Transduction Particles
LEM domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081193.2-2724s21c1
Sequence:CCGGTGCGGACTGGCCTAGCTAATTCTCGAGAATTAGCTAGGCCAGTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081193.2-1912s21c1
Sequence:CCGGTACTGTGACCCATAGGTTATTCTCGAGAATAACCTATGGGTCACAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081193.2-3967s21c1
Sequence:CCGGATAGTTACTGATCAAGGTTTACTCGAGTAAACCTTGATCAGTAACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081193.2-1531s21c1
Sequence:CCGGCGAGGACGGAGGACTCATAAACTCGAGTTTATGAGTCCTCCGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081193.2-2436s21c1
Sequence:CCGGTGGCGATCCAAGAAGCGATTTCTCGAGAAATCGCTTCTTGGATCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)