EMAIL THIS PAGE TO A FRIEND

LENEP

lens epithelial protein

77 Gene Product Result for
Synonyms: LEP503
UniProtKB ID: Q9Y5L5, B5BUM1, Q5T1A4
Gene ID:
Human(55891) Summary: The ocular lens is a tissue of epithelial origin and devoid of blood vessels and nerves. Cells of the lens epithelium are responsible for the growth and maintenance of the lens through mitosis, protein synthesis, and active transport of ions and metabolites across the lens capsule. Lens epithelial protein is expressed exclusively in lens epithelial cells and may play a role in cell differentiation. [provided by RefSeq, Jul 2008]
Mouse(57275) lens epithelial protein
Rat(113917) lens epithelial protein
sheep(101114657) lens epithelial protein
domestic guinea pig(100735576) lens epithelial protein
naked mole-rat(101715589) lens epithelial protein
Zebrafish(100002665) lens epithelial protein
domestic cat(101092162) lens epithelial protein
dog(100687198) lens epithelial protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018655 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018655 Rosetta Predictions human pricing
NM_053614 Rosetta Predictions rat pricing
NM_020517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204431 predicted 318
2 SASI_Hs01_00204432 predicted 310
3 SASI_Hs01_00204433 predicted 314
4 SASI_Hs01_00204434 predicted 196
5 SASI_Hs01_00204435 predicted 266
6 SASI_Hs01_00204436 predicted 239
7 SASI_Hs01_00204437 predicted 304
8 SASI_Hs02_00352157 predicted 346
9 SASI_Hs01_00204438 predicted 288
10 SASI_Hs01_00204439 predicted 357
11 SASI_Hs01_00204440 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035351 predicted 311
2 SASI_Rn01_00035352 predicted 344
3 SASI_Rn01_00035353 predicted 321
4 SASI_Rn01_00035354 predicted 311
5 SASI_Rn01_00035355 predicted 248
6 SASI_Rn01_00035356 predicted 276
7 SASI_Rn01_00035357 predicted 339
8 SASI_Rn01_00035358 predicted 327
9 SASI_Rn01_00035359 predicted 258
10 SASI_Rn02_00266317 predicted 301
11 SASI_Rn01_00035360 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039941 predicted 295
2 SASI_Mm01_00039942 predicted 771
3 SASI_Mm01_00039943 predicted 546
4 SASI_Mm01_00039944 predicted 272
5 SASI_Mm01_00039945 predicted 329
6 SASI_Mm01_00039946 predicted 717
7 SASI_Mm01_00039947 predicted 750
8 SASI_Mm01_00039948 predicted 710
9 SASI_Mm01_00039949 predicted 714
10 SASI_Mm01_00039950 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018655
LENEP MISSION shRNA Bacterial Glycerol Stock
lens epithelial protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018655.2-46s21c1
Sequence:CCGGAGCCCAAACCCTACCCTTCTTCTCGAGAAGAAGGGTAGGGTTTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018655.2-343s21c1
Sequence:CCGGTAAAGTGTGGATCCTGCTTTGCTCGAGCAAAGCAGGATCCACACTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018655.2-472s21c1
Sequence:CCGGCCCAGTAAGATTGTGGCAAGACTCGAGTCTTGCCACAATCTTACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018655.2-318s1c1
Sequence:CCGGTGGGCCATAAACAATGAGTAACTCGAGTTACTCATTGTTTATGGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-104s1c1
Sequence:CCGGCCTGTCATTAAGATGGGCACACTCGAGTGTGCCCATCTTAATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-147s1c1
Sequence:CCGGCCCTGAAGGAAGTCGCCTACACTCGAGTGTAGGCGACTTCCTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-97s1c1
Sequence:CCGGGCGGGTGCCTGTCATTAAGATCTCGAGATCTTAATGACAGGCACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-181s1c1
Sequence:CCGGCTGGTGTATCAAGGAACTGCTCTCGAGAGCAGTTCCTTGATACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018655
LENEP MISSION shRNA shRNA Plasmid DNA
lens epithelial protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018655.2-46s21c1
Sequence:CCGGAGCCCAAACCCTACCCTTCTTCTCGAGAAGAAGGGTAGGGTTTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018655.2-343s21c1
Sequence:CCGGTAAAGTGTGGATCCTGCTTTGCTCGAGCAAAGCAGGATCCACACTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018655.2-472s21c1
Sequence:CCGGCCCAGTAAGATTGTGGCAAGACTCGAGTCTTGCCACAATCTTACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018655.2-318s1c1
Sequence:CCGGTGGGCCATAAACAATGAGTAACTCGAGTTACTCATTGTTTATGGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-104s1c1
Sequence:CCGGCCTGTCATTAAGATGGGCACACTCGAGTGTGCCCATCTTAATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-147s1c1
Sequence:CCGGCCCTGAAGGAAGTCGCCTACACTCGAGTGTAGGCGACTTCCTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-97s1c1
Sequence:CCGGGCGGGTGCCTGTCATTAAGATCTCGAGATCTTAATGACAGGCACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-181s1c1
Sequence:CCGGCTGGTGTATCAAGGAACTGCTCTCGAGAGCAGTTCCTTGATACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018655
LENEP MISSION shRNA Lentiviral Transduction Particles
lens epithelial protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018655.2-46s21c1
Sequence:CCGGAGCCCAAACCCTACCCTTCTTCTCGAGAAGAAGGGTAGGGTTTGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018655.2-343s21c1
Sequence:CCGGTAAAGTGTGGATCCTGCTTTGCTCGAGCAAAGCAGGATCCACACTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018655.2-472s21c1
Sequence:CCGGCCCAGTAAGATTGTGGCAAGACTCGAGTCTTGCCACAATCTTACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018655.2-318s1c1
Sequence:CCGGTGGGCCATAAACAATGAGTAACTCGAGTTACTCATTGTTTATGGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-104s1c1
Sequence:CCGGCCTGTCATTAAGATGGGCACACTCGAGTGTGCCCATCTTAATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-147s1c1
Sequence:CCGGCCCTGAAGGAAGTCGCCTACACTCGAGTGTAGGCGACTTCCTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-97s1c1
Sequence:CCGGGCGGGTGCCTGTCATTAAGATCTCGAGATCTTAATGACAGGCACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018655.2-181s1c1
Sequence:CCGGCTGGTGTATCAAGGAACTGCTCTCGAGAGCAGTTCCTTGATACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020517
LENEP MISSION shRNA Bacterial Glycerol Stock
lens epithelial protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020517.2-227s1c1
Sequence:CCGGCTCCAGGTGCCTGTCATTAAACTCGAGTTTAATGACAGGCACCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020517.2-287s1c1
Sequence:CCGGGAAGTCGCCTACATCCTTCTTCTCGAGAAGAAGGATGTAGGCGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020517.2-290s1c1
Sequence:CCGGGTCGCCTACATCCTTCTTTGTCTCGAGACAAAGAAGGATGTAGGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020517.2-722s1c1
Sequence:CCGGCGTACTTGAAGAACTAGGAATCTCGAGATTCCTAGTTCTTCAAGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020517.2-1270s1c1
Sequence:CCGGCTTGCTTTCTTTGAACTGTTACTCGAGTAACAGTTCAAAGAAAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020517
LENEP MISSION shRNA shRNA Plasmid DNA
lens epithelial protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020517.2-227s1c1
Sequence:CCGGCTCCAGGTGCCTGTCATTAAACTCGAGTTTAATGACAGGCACCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020517.2-287s1c1
Sequence:CCGGGAAGTCGCCTACATCCTTCTTCTCGAGAAGAAGGATGTAGGCGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020517.2-290s1c1
Sequence:CCGGGTCGCCTACATCCTTCTTTGTCTCGAGACAAAGAAGGATGTAGGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020517.2-722s1c1
Sequence:CCGGCGTACTTGAAGAACTAGGAATCTCGAGATTCCTAGTTCTTCAAGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020517.2-1270s1c1
Sequence:CCGGCTTGCTTTCTTTGAACTGTTACTCGAGTAACAGTTCAAAGAAAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020517
LENEP MISSION shRNA Lentiviral Transduction Particles
lens epithelial protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020517.2-227s1c1
Sequence:CCGGCTCCAGGTGCCTGTCATTAAACTCGAGTTTAATGACAGGCACCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020517.2-287s1c1
Sequence:CCGGGAAGTCGCCTACATCCTTCTTCTCGAGAAGAAGGATGTAGGCGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020517.2-290s1c1
Sequence:CCGGGTCGCCTACATCCTTCTTTGTCTCGAGACAAAGAAGGATGTAGGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020517.2-722s1c1
Sequence:CCGGCGTACTTGAAGAACTAGGAATCTCGAGATTCCTAGTTCTTCAAGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020517.2-1270s1c1
Sequence:CCGGCTTGCTTTCTTTGAACTGTTACTCGAGTAACAGTTCAAAGAAAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)