EMAIL THIS PAGE TO A FRIEND

LENG8

leukocyte receptor cluster (LRC) member 8

175 Gene Product Result for
Synonyms: pp13842
UniProtKB ID: Q96PV6, B0VJY9, Q8IZ27, Q8NCX6
Gene ID:
Mouse(232798) leukocyte receptor cluster (LRC) member 8
Rat(361506) leukocyte receptor cluster (LRC) member 8
sheep(101105522) leukocyte receptor cluster (LRC) member 8
Domestic Rabbit(100328781) leukocyte receptor cluster (LRC) member 8
domestic guinea pig(100723708) leukocyte receptor cluster (LRC) member 8
naked mole-rat(101718889) leukocyte receptor cluster (LRC) member 8
domestic cat(101095533) leukocyte receptor cluster (LRC) member 8
cow(526370) leukocyte receptor cluster (LRC) member 8
Horse(100050072) leukocyte receptor cluster (LRC) member 8
dog(476385) leukocyte receptor cluster (LRC) member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052925 Rosetta Predictions human pricing
NM_001037790 Rosetta Predictions rat pricing
XM_001058154 Rosetta Predictions rat pricing
XM_001058218 Rosetta Predictions rat pricing
XM_001065340 Rosetta Predictions rat pricing
XM_001065397 Rosetta Predictions rat pricing
NM_172736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085103 predicted 892
2 SASI_Hs01_00085104 predicted 761
3 SASI_Hs01_00085105 predicted 800
4 SASI_Hs02_00361685 predicted 462
5 SASI_Hs01_00085107 predicted 2494
6 SASI_Hs01_00085108 predicted 1349
7 SASI_Hs01_00085109 predicted 2141
8 SASI_Hs01_00085110 predicted 1379
9 SASI_Hs01_00085111 predicted 1904
10 SASI_Hs01_00085112 predicted 2484
11 SASI_Hs01_00085106 predicted 2370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204599 predicted 814
2 SASI_Rn02_00204600 predicted 2628
3 SASI_Rn02_00204601 predicted 1037
4 SASI_Rn02_00204602 predicted 2628
5 SASI_Rn02_00204603 predicted 2663
6 SASI_Rn02_00204604 predicted 1632
7 SASI_Rn02_00204605 predicted 675
8 SASI_Rn02_00204606 predicted 416
9 SASI_Rn02_00204607 predicted 2713
10 SASI_Rn02_00204608 predicted 2073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288765 predicted 773
2 SASI_Rn02_00288766 predicted 2584
3 SASI_Rn02_00288767 predicted 995
4 SASI_Rn02_00288768 predicted 2578
5 SASI_Rn02_00288769 predicted 2615
6 SASI_Rn02_00288770 predicted 1584
7 SASI_Rn02_00288771 predicted 628
8 SASI_Rn02_00288772 predicted 362
9 SASI_Rn02_00288773 predicted 2665
10 SASI_Rn02_00288774 predicted 2021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289002 predicted 813
2 SASI_Rn02_00289003 predicted 2624
3 SASI_Rn02_00289004 predicted 1045
4 SASI_Rn02_00289005 predicted 2628
5 SASI_Rn02_00289006 predicted 2663
6 SASI_Rn02_00289007 predicted 1633
7 SASI_Rn02_00289008 predicted 676
8 SASI_Rn02_00289009 predicted 416
9 SASI_Rn02_00289010 predicted 2714
10 SASI_Rn02_00289011 predicted 2071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313777 predicted 767
2 SASI_Rn02_00313778 predicted 2578
3 SASI_Rn02_00313779 predicted 996
4 SASI_Rn02_00313780 predicted 2577
5 SASI_Rn02_00313781 predicted 2616
6 SASI_Rn02_00313782 predicted 1585
7 SASI_Rn02_00313783 predicted 623
8 SASI_Rn02_00313784 predicted 362
9 SASI_Rn02_00313785 predicted 2667
10 SASI_Rn02_00313786 predicted 2029
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313984 predicted 813
2 SASI_Rn02_00313985 predicted 2628
3 SASI_Rn02_00313986 predicted 1044
4 SASI_Rn02_00313987 predicted 2629
5 SASI_Rn02_00313988 predicted 2668
6 SASI_Rn02_00313989 predicted 1630
7 SASI_Rn02_00313990 predicted 677
8 SASI_Rn02_00313991 predicted 412
9 SASI_Rn02_00313992 predicted 2722
10 SASI_Rn02_00313993 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344554 predicted 898
2 SASI_Mm02_00344555 predicted 659
3 SASI_Mm02_00344556 predicted 1724
4 SASI_Mm02_00344557 predicted 804
5 SASI_Mm02_00344558 predicted 760
6 SASI_Mm02_00344559 predicted 2126
7 SASI_Mm02_00344560 predicted 1627
8 SASI_Mm02_00344561 predicted 2331
9 SASI_Mm02_00344562 predicted 423
10 SASI_Mm02_00344563 predicted 1445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052925
LENG8 MISSION shRNA Bacterial Glycerol Stock
leukocyte receptor cluster (LRC) member 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052925.2-1196s21c1
Sequence:CCGGGAAGCGACCCTTTGCTGTTACCTCGAGGTAACAGCAAAGGGTCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052925.2-2697s21c1
Sequence:CCGGGCCCTCAAGGCCATGATCAAACTCGAGTTTGATCATGGCCTTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052925.2-2953s21c1
Sequence:CCGGGCCGTGGACTTGGGTTGTAAACTCGAGTTTACAACCCAAGTCCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052925.2-2528s21c1
Sequence:CCGGGGCATACCTCACACGAGAACTCTCGAGAGTTCTCGTGTGAGGTATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2109s1c1
Sequence:CCGGGCCGAGAACTTGCCTGGCAATCTCGAGATTGCCAGGCAAGTTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2135s1c1
Sequence:CCGGCGAGTTTACTGCCTACCGAATCTCGAGATTCGGTAGGCAGTAAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2337s1c1
Sequence:CCGGCTCGTGGACAAGTTTGCAGATCTCGAGATCTGCAAACTTGTCCACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-848s1c1
Sequence:CCGGTGGAGGTCTCAAGTTCAACATCTCGAGATGTTGAACTTGAGACCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2156s1c1
Sequence:CCGGCCTCTACTACATCTTCACCAACTCGAGTTGGTGAAGATGTAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052925
LENG8 MISSION shRNA shRNA Plasmid DNA
leukocyte receptor cluster (LRC) member 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052925.2-1196s21c1
Sequence:CCGGGAAGCGACCCTTTGCTGTTACCTCGAGGTAACAGCAAAGGGTCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052925.2-2697s21c1
Sequence:CCGGGCCCTCAAGGCCATGATCAAACTCGAGTTTGATCATGGCCTTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052925.2-2953s21c1
Sequence:CCGGGCCGTGGACTTGGGTTGTAAACTCGAGTTTACAACCCAAGTCCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052925.2-2528s21c1
Sequence:CCGGGGCATACCTCACACGAGAACTCTCGAGAGTTCTCGTGTGAGGTATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2109s1c1
Sequence:CCGGGCCGAGAACTTGCCTGGCAATCTCGAGATTGCCAGGCAAGTTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2135s1c1
Sequence:CCGGCGAGTTTACTGCCTACCGAATCTCGAGATTCGGTAGGCAGTAAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2337s1c1
Sequence:CCGGCTCGTGGACAAGTTTGCAGATCTCGAGATCTGCAAACTTGTCCACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-848s1c1
Sequence:CCGGTGGAGGTCTCAAGTTCAACATCTCGAGATGTTGAACTTGAGACCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2156s1c1
Sequence:CCGGCCTCTACTACATCTTCACCAACTCGAGTTGGTGAAGATGTAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052925
LENG8 MISSION shRNA Lentiviral Transduction Particles
leukocyte receptor cluster (LRC) member 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052925.2-1196s21c1
Sequence:CCGGGAAGCGACCCTTTGCTGTTACCTCGAGGTAACAGCAAAGGGTCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052925.2-2697s21c1
Sequence:CCGGGCCCTCAAGGCCATGATCAAACTCGAGTTTGATCATGGCCTTGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052925.2-2953s21c1
Sequence:CCGGGCCGTGGACTTGGGTTGTAAACTCGAGTTTACAACCCAAGTCCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052925.2-2528s21c1
Sequence:CCGGGGCATACCTCACACGAGAACTCTCGAGAGTTCTCGTGTGAGGTATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2109s1c1
Sequence:CCGGGCCGAGAACTTGCCTGGCAATCTCGAGATTGCCAGGCAAGTTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2135s1c1
Sequence:CCGGCGAGTTTACTGCCTACCGAATCTCGAGATTCGGTAGGCAGTAAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2337s1c1
Sequence:CCGGCTCGTGGACAAGTTTGCAGATCTCGAGATCTGCAAACTTGTCCACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-848s1c1
Sequence:CCGGTGGAGGTCTCAAGTTCAACATCTCGAGATGTTGAACTTGAGACCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052925.1-2156s1c1
Sequence:CCGGCCTCTACTACATCTTCACCAACTCGAGTTGGTGAAGATGTAGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172736
VALIDATED
LENG8 MISSION shRNA Bacterial Glycerol Stock
leukocyte receptor cluster (LRC) member 8
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-813s21c1
Sequence:CCGGAGTTATGGACCCGCATGAAACCTCGAGGTTTCATGCGGGTCCATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172736.3-2712s21c1
Sequence:CCGGAGGGTGACTTGATTCATATTGCTCGAGCAATATGAATCAAGTCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-2289s21c1
Sequence:CCGGACCGCTTCTTCAGGCTCTATTCTCGAGAATAGAGCCTGAAGAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-1037s21c1
Sequence:CCGGGAATATGTGGAACGGTGTTTCCTCGAGGAAACACCGTTCCACATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-673s21c1
Sequence:CCGGACATGGGACACATAGTCTAAGCTCGAGCTTAGACTATGTGTCCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-424s21c1
Sequence:CCGGCCAGCAGTACAACTATGCCTACTCGAGTAGGCATAGTTGTACTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172736.2-4753s1c1
Sequence:CCGGCCCTGGTTCAACACAGGTAAACTCGAGTTTACCTGTGTTGAACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172736.2-2120s1c1
Sequence:CCGGGCAGGCAATGTGGGTGAATTTCTCGAGAAATTCACCCACATTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172736.2-1022s1c1
Sequence:CCGGCCTCAGGATATGAAGGAATATCTCGAGATATTCCTTCATATCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172736.2-1817s1c1
Sequence:CCGGCCTGACATTACAAAGCACTATCTCGAGATAGTGCTTTGTAATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172736.2-424s1c1
Sequence:CCGGCCAGCAGTACAACTATGCCTACTCGAGTAGGCATAGTTGTACTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172736
VALIDATED
LENG8 MISSION shRNA shRNA Plasmid DNA
leukocyte receptor cluster (LRC) member 8
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-813s21c1
Sequence:CCGGAGTTATGGACCCGCATGAAACCTCGAGGTTTCATGCGGGTCCATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172736.3-2712s21c1
Sequence:CCGGAGGGTGACTTGATTCATATTGCTCGAGCAATATGAATCAAGTCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-2289s21c1
Sequence:CCGGACCGCTTCTTCAGGCTCTATTCTCGAGAATAGAGCCTGAAGAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-1037s21c1
Sequence:CCGGGAATATGTGGAACGGTGTTTCCTCGAGGAAACACCGTTCCACATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-673s21c1
Sequence:CCGGACATGGGACACATAGTCTAAGCTCGAGCTTAGACTATGTGTCCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-424s21c1
Sequence:CCGGCCAGCAGTACAACTATGCCTACTCGAGTAGGCATAGTTGTACTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172736.2-4753s1c1
Sequence:CCGGCCCTGGTTCAACACAGGTAAACTCGAGTTTACCTGTGTTGAACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172736.2-2120s1c1
Sequence:CCGGGCAGGCAATGTGGGTGAATTTCTCGAGAAATTCACCCACATTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172736.2-1022s1c1
Sequence:CCGGCCTCAGGATATGAAGGAATATCTCGAGATATTCCTTCATATCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172736.2-1817s1c1
Sequence:CCGGCCTGACATTACAAAGCACTATCTCGAGATAGTGCTTTGTAATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172736.2-424s1c1
Sequence:CCGGCCAGCAGTACAACTATGCCTACTCGAGTAGGCATAGTTGTACTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172736
VALIDATED
LENG8 MISSION shRNA Lentiviral Transduction Particles
leukocyte receptor cluster (LRC) member 8
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-813s21c1
Sequence:CCGGAGTTATGGACCCGCATGAAACCTCGAGGTTTCATGCGGGTCCATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172736.3-2712s21c1
Sequence:CCGGAGGGTGACTTGATTCATATTGCTCGAGCAATATGAATCAAGTCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-2289s21c1
Sequence:CCGGACCGCTTCTTCAGGCTCTATTCTCGAGAATAGAGCCTGAAGAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-1037s21c1
Sequence:CCGGGAATATGTGGAACGGTGTTTCCTCGAGGAAACACCGTTCCACATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-673s21c1
Sequence:CCGGACATGGGACACATAGTCTAAGCTCGAGCTTAGACTATGTGTCCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172736.3-424s21c1
Sequence:CCGGCCAGCAGTACAACTATGCCTACTCGAGTAGGCATAGTTGTACTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172736.2-4753s1c1
Sequence:CCGGCCCTGGTTCAACACAGGTAAACTCGAGTTTACCTGTGTTGAACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172736.2-2120s1c1
Sequence:CCGGGCAGGCAATGTGGGTGAATTTCTCGAGAAATTCACCCACATTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172736.2-1022s1c1
Sequence:CCGGCCTCAGGATATGAAGGAATATCTCGAGATATTCCTTCATATCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172736.2-1817s1c1
Sequence:CCGGCCTGACATTACAAAGCACTATCTCGAGATAGTGCTTTGTAATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172736.2-424s1c1
Sequence:CCGGCCAGCAGTACAACTATGCCTACTCGAGTAGGCATAGTTGTACTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)