EMAIL THIS PAGE TO A FRIEND

LENG9

leukocyte receptor cluster (LRC) member 9

91 Gene Product Result for
UniProtKB ID: Q96B70, B2VAM3
Gene ID:
Mouse(243813) leukocyte receptor cluster (LRC) member 9
Rat(292596) leukocyte receptor cluster (LRC) member 9
Zebrafish(768155) leukocyte receptor cluster (LRC) member 9
cow(526369) leukocyte receptor cluster (LRC) member 9
cow(101907522) leukocyte receptor cluster (LRC) member 9
domestic cat(101095296) leukocyte receptor cluster (LRC) member 9
domestic guinea pig(100722967) leukocyte receptor cluster (LRC) member 9
sheep(101105773) leukocyte receptor cluster (LRC) member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198988 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198988 Rosetta Predictions human pricing
XM_001058345 Rosetta Predictions rat pricing
XM_214812 Rosetta Predictions rat pricing
NM_175529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016456 predicted 432
2 SASI_Hs01_00016457 predicted 842
3 SASI_Hs01_00016458 predicted 1367
4 SASI_Hs01_00016460 predicted 883
5 SASI_Hs01_00016461 predicted 426
6 SASI_Hs01_00016462 predicted 840
7 SASI_Hs01_00016463 predicted 567
8 SASI_Hs01_00016464 predicted 1184
9 SASI_Hs01_00016465 predicted 1381
10 SASI_Hs02_00372495 predicted 649
11 SASI_Hs01_00016459 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289381 predicted 1789
2 SASI_Rn02_00289382 predicted 1946
3 SASI_Rn02_00289383 predicted 1634
4 SASI_Rn02_00289384 predicted 1559
5 SASI_Rn02_00289385 predicted 1533
6 SASI_Rn02_00289386 predicted 1846
7 SASI_Rn02_00289387 predicted 1924
8 SASI_Rn02_00289388 predicted 1438
9 SASI_Rn02_00289389 predicted 1038
10 SASI_Rn02_00289390 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375607 predicted 1793
2 SASI_Rn02_00375608 predicted 1944
3 SASI_Rn02_00375609 predicted 1638
4 SASI_Rn02_00375610 predicted 1566
5 SASI_Rn02_00375611 predicted 1528
6 SASI_Rn02_00375612 predicted 1845
7 SASI_Rn02_00375613 predicted 1927
8 SASI_Rn02_00375614 predicted 1436
9 SASI_Rn02_00375615 predicted 1041
10 SASI_Rn02_00375616 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175255 predicted 1059
2 SASI_Mm02_00346470 predicted 902
3 SASI_Mm01_00175258 predicted 914
4 SASI_Mm01_00175259 predicted 1240
5 SASI_Mm01_00175260 predicted 943
6 SASI_Mm01_00175262 predicted 1054
7 SASI_Mm01_00175263 predicted 896
8 SASI_Mm01_00175264 predicted 1283
9 SASI_Mm02_00346471 predicted 761
10 SASI_Mm02_00346472 predicted 1291
11 SASI_Mm01_00175256 predicted 1416
12 SASI_Mm01_00175257 predicted 1443
13 SASI_Mm01_00175261 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175529
LENG9 MISSION shRNA Bacterial Glycerol Stock
leukocyte receptor cluster (LRC) member 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1421s1c1
Sequence:CCGGCCAAACACTGAATCAGAGGCTCTCGAGAGCCTCTGATTCAGTGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-938s1c1
Sequence:CCGGCATGAACTTCTCAGGAGTGAACTCGAGTTCACTCCTGAGAAGTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1039s1c1
Sequence:CCGGCTGAAGAGATGGGAAATGTGTCTCGAGACACATTTCCCATCTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-822s1c1
Sequence:CCGGGCAATCAAAGAGACCAGAACTCTCGAGAGTTCTGGTCTCTTTGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-941s1c1
Sequence:CCGGGAACTTCTCAGGAGTGAAGATCTCGAGATCTTCACTCCTGAGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-933s1c1
Sequence:CCGGCCAAGCATGAACTTCTCAGGACTCGAGTCCTGAGAAGTTCATGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1422s1c1
Sequence:CCGGCAAACACTGAATCAGAGGCTACTCGAGTAGCCTCTGATTCAGTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1015s1c1
Sequence:CCGGGCATGGAAACGAAAGGGCTTTCTCGAGAAAGCCCTTTCGTTTCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175529
LENG9 MISSION shRNA shRNA Plasmid DNA
leukocyte receptor cluster (LRC) member 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1421s1c1
Sequence:CCGGCCAAACACTGAATCAGAGGCTCTCGAGAGCCTCTGATTCAGTGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-938s1c1
Sequence:CCGGCATGAACTTCTCAGGAGTGAACTCGAGTTCACTCCTGAGAAGTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1039s1c1
Sequence:CCGGCTGAAGAGATGGGAAATGTGTCTCGAGACACATTTCCCATCTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-822s1c1
Sequence:CCGGGCAATCAAAGAGACCAGAACTCTCGAGAGTTCTGGTCTCTTTGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-941s1c1
Sequence:CCGGGAACTTCTCAGGAGTGAAGATCTCGAGATCTTCACTCCTGAGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-933s1c1
Sequence:CCGGCCAAGCATGAACTTCTCAGGACTCGAGTCCTGAGAAGTTCATGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1422s1c1
Sequence:CCGGCAAACACTGAATCAGAGGCTACTCGAGTAGCCTCTGATTCAGTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1015s1c1
Sequence:CCGGGCATGGAAACGAAAGGGCTTTCTCGAGAAAGCCCTTTCGTTTCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175529
LENG9 MISSION shRNA Lentiviral Transduction Particles
leukocyte receptor cluster (LRC) member 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1421s1c1
Sequence:CCGGCCAAACACTGAATCAGAGGCTCTCGAGAGCCTCTGATTCAGTGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-938s1c1
Sequence:CCGGCATGAACTTCTCAGGAGTGAACTCGAGTTCACTCCTGAGAAGTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1039s1c1
Sequence:CCGGCTGAAGAGATGGGAAATGTGTCTCGAGACACATTTCCCATCTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-822s1c1
Sequence:CCGGGCAATCAAAGAGACCAGAACTCTCGAGAGTTCTGGTCTCTTTGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-941s1c1
Sequence:CCGGGAACTTCTCAGGAGTGAAGATCTCGAGATCTTCACTCCTGAGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-933s1c1
Sequence:CCGGCCAAGCATGAACTTCTCAGGACTCGAGTCCTGAGAAGTTCATGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1422s1c1
Sequence:CCGGCAAACACTGAATCAGAGGCTACTCGAGTAGCCTCTGATTCAGTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175529.2-1015s1c1
Sequence:CCGGGCATGGAAACGAAAGGGCTTTCTCGAGAAAGCCCTTTCGTTTCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198988
LENG9 MISSION shRNA Bacterial Glycerol Stock
leukocyte receptor cluster (LRC) member 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198988.1-1318s21c1
Sequence:CCGGTTAGAAAGCTGGTCCTCCTGGCTCGAGCCAGGAGGACCAGCTTTCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-1310s1c1
Sequence:CCGGGCTGAGCTTTAGAAAGCTGGTCTCGAGACCAGCTTTCTAAAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-1187s1c1
Sequence:CCGGGCCCTCTCAGAACCTACACCTCTCGAGAGGTGTAGGTTCTGAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-558s1c1
Sequence:CCGGGTGCGCTTCTTCCGCTTCCATCTCGAGATGGAAGCGGAAGAAGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-1125s1c1
Sequence:CCGGGAAGTGACCAAGGCCCAGGAACTCGAGTTCCTGGGCCTTGGTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198988.1-1419s21c1
Sequence:CCGGGGGCTGAGTACACTACAGTCTCTCGAGAGACTGTAGTGTACTCAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198988.1-1554s21c1
Sequence:CCGGACACTCTGGCTGTGCCGTATACTCGAGTATACGGCACAGCCAGAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198988
LENG9 MISSION shRNA shRNA Plasmid DNA
leukocyte receptor cluster (LRC) member 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198988.1-1318s21c1
Sequence:CCGGTTAGAAAGCTGGTCCTCCTGGCTCGAGCCAGGAGGACCAGCTTTCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-1310s1c1
Sequence:CCGGGCTGAGCTTTAGAAAGCTGGTCTCGAGACCAGCTTTCTAAAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-1187s1c1
Sequence:CCGGGCCCTCTCAGAACCTACACCTCTCGAGAGGTGTAGGTTCTGAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-558s1c1
Sequence:CCGGGTGCGCTTCTTCCGCTTCCATCTCGAGATGGAAGCGGAAGAAGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-1125s1c1
Sequence:CCGGGAAGTGACCAAGGCCCAGGAACTCGAGTTCCTGGGCCTTGGTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198988.1-1419s21c1
Sequence:CCGGGGGCTGAGTACACTACAGTCTCTCGAGAGACTGTAGTGTACTCAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198988.1-1554s21c1
Sequence:CCGGACACTCTGGCTGTGCCGTATACTCGAGTATACGGCACAGCCAGAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198988
LENG9 MISSION shRNA Lentiviral Transduction Particles
leukocyte receptor cluster (LRC) member 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198988.1-1318s21c1
Sequence:CCGGTTAGAAAGCTGGTCCTCCTGGCTCGAGCCAGGAGGACCAGCTTTCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-1310s1c1
Sequence:CCGGGCTGAGCTTTAGAAAGCTGGTCTCGAGACCAGCTTTCTAAAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-1187s1c1
Sequence:CCGGGCCCTCTCAGAACCTACACCTCTCGAGAGGTGTAGGTTCTGAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-558s1c1
Sequence:CCGGGTGCGCTTCTTCCGCTTCCATCTCGAGATGGAAGCGGAAGAAGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198988.1-1125s1c1
Sequence:CCGGGAAGTGACCAAGGCCCAGGAACTCGAGTTCCTGGGCCTTGGTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198988.1-1419s21c1
Sequence:CCGGGGGCTGAGTACACTACAGTCTCTCGAGAGACTGTAGTGTACTCAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198988.1-1554s21c1
Sequence:CCGGACACTCTGGCTGTGCCGTATACTCGAGTATACGGCACAGCCAGAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)