EMAIL THIS PAGE TO A FRIEND

LEO1

Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)

57 Gene Product Result for
Synonyms: RDL
UniProtKB ID: Q8WVC0, Q96N99
Gene ID:
Human(123169) Summary: LEO1, parafibromin (CDC73; MIM 607393), CTR9 (MIM 609366), and PAF1 (MIM 610506) form the PAF protein complex that associates with the RNA polymerase II subunit POLR2A (MIM 180660) and with a histone methyltransferase complex (Rozenblatt-Rosen et al., 2005 [PubMed 15632063]
Mouse(235497) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Rat(300837) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
sheep(101103573) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Domestic Rabbit(100357669) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
domestic guinea pig(100722638) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
naked mole-rat(101701751) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Zebrafish(404599) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
dog(478310) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
cow(507524) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Horse(100055050) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
domestic cat(101093525) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
chicken(769405) Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138792 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001006122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001006122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001006122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138792 Rosetta Predictions human pricing
NM_001005548 Rosetta Predictions rat pricing
NM_001039522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363938 predicted 1185
2 SASI_Hs01_00060484 predicted 637
3 SASI_Hs01_00060485 predicted 265
4 SASI_Hs02_00363939 predicted 1557
5 SASI_Hs01_00060486 predicted 968
6 SASI_Hs01_00060487 predicted 523
7 SASI_Hs01_00060488 predicted 252
8 SASI_Hs01_00060489 predicted 1526
9 SASI_Hs01_00060491 predicted 1894
10 SASI_Hs01_00060492 predicted 226
11 SASI_Hs01_00060490 predicted 1161
12 SASI_Hs01_00060493 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085677 predicted 1218
2 SASI_Rn01_00085678 predicted 980
3 SASI_Rn01_00085679 predicted 1589
4 SASI_Rn01_00085680 predicted 624
5 SASI_Rn01_00085681 predicted 1176
6 SASI_Rn01_00085682 predicted 1403
7 SASI_Rn01_00085683 predicted 674
8 SASI_Rn01_00085684 predicted 1360
9 SASI_Rn01_00085685 predicted 995
10 SASI_Rn01_00085686 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027703 predicted 1593
2 SASI_Mm01_00027704 predicted 1881
3 SASI_Mm01_00027705 predicted 377
4 SASI_Mm01_00027706 predicted 293
5 SASI_Mm01_00027707 predicted 1183
6 SASI_Mm01_00027708 predicted 476
7 SASI_Mm01_00027709 predicted 1375
8 SASI_Mm01_00027710 predicted 1878
9 SASI_Mm01_00027711 predicted 1199
10 SASI_Mm01_00027712 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138792
VALIDATED
LEO1 MISSION shRNA Bacterial Glycerol Stock
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-62s21c1
Sequence:CCGGGCTGAGCGTAAAGATTCTGATCTCGAGATCAGAATCTTTACGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-182s21c1
Sequence:CCGGCCAAGTAATAAGGAACTGTTTCTCGAGAAACAGTTCCTTATTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-1289s21c1
Sequence:CCGGCGCCGAGATGAAGAAGGAAATCTCGAGATTTCCTTCTTCATCTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-1118s21c1
Sequence:CCGGGATTTAGGAAACGACTTATATCTCGAGATATAAGTCGTTTCCTAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-1289s1c1
Sequence:CCGGCGCCGAGATGAAGAAGGAAATCTCGAGATTTCCTTCTTCATCTCGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-1187s1c1
Sequence:CCGGCCTCAGTATTATGAAGATGAACTCGAGTTCATCTTCATAATACTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-182s1c1
Sequence:CCGGCCAAGTAATAAGGAACTGTTTCTCGAGAAACAGTTCCTTATTACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-62s1c1
Sequence:CCGGGCTGAGCGTAAAGATTCTGATCTCGAGATCAGAATCTTTACGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-1889s1c1
Sequence:CCGGGCAAAGAAACTTACCAGTGATCTCGAGATCACTGGTAAGTTTCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138792
VALIDATED
LEO1 MISSION shRNA shRNA Plasmid DNA
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-62s21c1
Sequence:CCGGGCTGAGCGTAAAGATTCTGATCTCGAGATCAGAATCTTTACGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-182s21c1
Sequence:CCGGCCAAGTAATAAGGAACTGTTTCTCGAGAAACAGTTCCTTATTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-1289s21c1
Sequence:CCGGCGCCGAGATGAAGAAGGAAATCTCGAGATTTCCTTCTTCATCTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-1118s21c1
Sequence:CCGGGATTTAGGAAACGACTTATATCTCGAGATATAAGTCGTTTCCTAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-1289s1c1
Sequence:CCGGCGCCGAGATGAAGAAGGAAATCTCGAGATTTCCTTCTTCATCTCGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-1187s1c1
Sequence:CCGGCCTCAGTATTATGAAGATGAACTCGAGTTCATCTTCATAATACTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-182s1c1
Sequence:CCGGCCAAGTAATAAGGAACTGTTTCTCGAGAAACAGTTCCTTATTACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-62s1c1
Sequence:CCGGGCTGAGCGTAAAGATTCTGATCTCGAGATCAGAATCTTTACGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-1889s1c1
Sequence:CCGGGCAAAGAAACTTACCAGTGATCTCGAGATCACTGGTAAGTTTCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138792
VALIDATED
LEO1 MISSION shRNA Lentiviral Transduction Particles
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-62s21c1
Sequence:CCGGGCTGAGCGTAAAGATTCTGATCTCGAGATCAGAATCTTTACGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-182s21c1
Sequence:CCGGCCAAGTAATAAGGAACTGTTTCTCGAGAAACAGTTCCTTATTACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-1289s21c1
Sequence:CCGGCGCCGAGATGAAGAAGGAAATCTCGAGATTTCCTTCTTCATCTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_138792.2-1118s21c1
Sequence:CCGGGATTTAGGAAACGACTTATATCTCGAGATATAAGTCGTTTCCTAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-1289s1c1
Sequence:CCGGCGCCGAGATGAAGAAGGAAATCTCGAGATTTCCTTCTTCATCTCGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-1187s1c1
Sequence:CCGGCCTCAGTATTATGAAGATGAACTCGAGTTCATCTTCATAATACTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-182s1c1
Sequence:CCGGCCAAGTAATAAGGAACTGTTTCTCGAGAAACAGTTCCTTATTACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-62s1c1
Sequence:CCGGGCTGAGCGTAAAGATTCTGATCTCGAGATCAGAATCTTTACGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138792.2-1889s1c1
Sequence:CCGGGCAAAGAAACTTACCAGTGATCTCGAGATCACTGGTAAGTTTCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039522
VALIDATED
LEO1 MISSION shRNA Bacterial Glycerol Stock
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1648s21c1
Sequence:CCGGCAGCGCACAGAGATGATTAAGCTCGAGCTTAATCATCTCTGTGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1987s21c1
Sequence:CCGGGACGATGACAAAGCGAATAAACTCGAGTTTATTCGCTTTGTCATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1001s21c1
Sequence:CCGGTCGGAGGTGCAGATGACATATCTCGAGATATGTCATCTGCACCTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1159s21c1
Sequence:CCGGGACTTGGGCAATGACTTATATCTCGAGATATAAGTCATTGCCCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039522.1-331s21c1
Sequence:CCGGCGCTCTGACCACGAGGATAATCTCGAGATTATCCTCGTGGTCAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039522
VALIDATED
LEO1 MISSION shRNA shRNA Plasmid DNA
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1648s21c1
Sequence:CCGGCAGCGCACAGAGATGATTAAGCTCGAGCTTAATCATCTCTGTGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1987s21c1
Sequence:CCGGGACGATGACAAAGCGAATAAACTCGAGTTTATTCGCTTTGTCATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1001s21c1
Sequence:CCGGTCGGAGGTGCAGATGACATATCTCGAGATATGTCATCTGCACCTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1159s21c1
Sequence:CCGGGACTTGGGCAATGACTTATATCTCGAGATATAAGTCATTGCCCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039522.1-331s21c1
Sequence:CCGGCGCTCTGACCACGAGGATAATCTCGAGATTATCCTCGTGGTCAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039522
VALIDATED
LEO1 MISSION shRNA Lentiviral Transduction Particles
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1648s21c1
Sequence:CCGGCAGCGCACAGAGATGATTAAGCTCGAGCTTAATCATCTCTGTGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1987s21c1
Sequence:CCGGGACGATGACAAAGCGAATAAACTCGAGTTTATTCGCTTTGTCATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1001s21c1
Sequence:CCGGTCGGAGGTGCAGATGACATATCTCGAGATATGTCATCTGCACCTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039522.1-1159s21c1
Sequence:CCGGGACTTGGGCAATGACTTATATCTCGAGATATAAGTCATTGCCCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039522.1-331s21c1
Sequence:CCGGCGCTCTGACCACGAGGATAATCTCGAGATTATCCTCGTGGTCAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006122
LEO1 MISSION shRNA Bacterial Glycerol Stock
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000190665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006122.1-702s1c1
Sequence:CCGGGCATCCAGTAGCTTCTGATAACTCGAGTTATCAGAAGCTACTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006122.1-1001s1c1
Sequence:CCGGGTCTGCTTCATAGCTCTCTGTCTCGAGACAGAGAGCTATGAAGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006122.1-802s1c1
Sequence:CCGGGAAAGGCCACAAGTCTCAGATCTCGAGATCTGAGACTTGTGGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006122
LEO1 MISSION shRNA shRNA Plasmid DNA
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000190665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006122.1-702s1c1
Sequence:CCGGGCATCCAGTAGCTTCTGATAACTCGAGTTATCAGAAGCTACTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006122.1-1001s1c1
Sequence:CCGGGTCTGCTTCATAGCTCTCTGTCTCGAGACAGAGAGCTATGAAGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006122.1-802s1c1
Sequence:CCGGGAAAGGCCACAAGTCTCAGATCTCGAGATCTGAGACTTGTGGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006122
LEO1 MISSION shRNA Lentiviral Transduction Particles
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000190665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006122.1-702s1c1
Sequence:CCGGGCATCCAGTAGCTTCTGATAACTCGAGTTATCAGAAGCTACTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006122.1-1001s1c1
Sequence:CCGGGTCTGCTTCATAGCTCTCTGTCTCGAGACAGAGAGCTATGAAGCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006122.1-802s1c1
Sequence:CCGGGAAAGGCCACAAGTCTCAGATCTCGAGATCTGAGACTTGTGGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)