EMAIL THIS PAGE TO A FRIEND

LEP

leptin

200 Gene Product Result for
Synonyms: LEPD OB OBS
UniProtKB ID: P41159, O15158, Q56A88
Gene ID:
Human(3952) Summary: This gene encodes a protein that is secreted by white adipocytes, and which plays a major role in the regulation of body weight. This protein, which acts through the leptin receptor, functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing. Mutations in this gene and/or its regulatory regions cause severe obesity, and morbid obesity with hypogonadism. This gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Jul 2008]
Mouse(16846) leptin
Rat(25608) leptin
fruit fly(5658637) leprechaun
cow(280836) leptin
dog(403616) leptin
Thale Cress(831238) ethylene-responsive transcription factor LEP
sheep(443534) leptin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000230 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012751 MISSION® esiRNA esiRNA targeting human LEP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000230 Rosetta Predictions human pricing
NM_013076 Rosetta Predictions rat pricing
NM_008493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302134 predicted 599
2 SASI_Hs01_00182971 predicted 673
3 SASI_Hs01_00182972 predicted 327
4 SASI_Hs01_00182973 predicted 741
5 SASI_Hs01_00182974 predicted 704
6 SASI_Hs01_00182975 predicted 672
7 SASI_Hs01_00182977 predicted 1016
8 SASI_Hs02_00302135 predicted 570
9 SASI_Hs02_00302136 predicted 670
10 SASI_Hs01_00182978 predicted 361
11 SASI_Hs01_00182970 predicted 694
12 SASI_Hs01_00182976 predicted 572
13 SASI_Hs01_00182979 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260832 predicted 261
2 SASI_Rn02_00260833 predicted 278
3 SASI_Rn02_00260834 predicted 277
4 SASI_Rn02_00260835 predicted 262
5 SASI_Rn01_00101808 predicted 308
6 SASI_Rn02_00260836 predicted 258
7 SASI_Rn01_00101813 predicted 208
8 SASI_Rn02_00260837 predicted 261
9 SASI_Rn02_00260838 predicted 303
10 SASI_Rn02_00260839 predicted 209
11 SASI_Rn01_00101805 predicted 231
12 SASI_Rn01_00101806 predicted 225
13 SASI_Rn01_00101807 predicted 441
14 SASI_Rn01_00101809 predicted 390
15 SASI_Rn01_00101810 predicted 466
16 SASI_Rn01_00101811 predicted 212
17 SASI_Rn01_00101812 predicted 414
18 SASI_Rn01_00101814 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116215 predicted 636
2 SASI_Mm01_00116217 predicted 985
3 SASI_Mm01_00116218 predicted 543
4 SASI_Mm01_00116219 predicted 229
5 SASI_Mm01_00116220 predicted 456
6 SASI_Mm01_00116221 predicted 724
7 SASI_Mm01_00116222 predicted 376
8 SASI_Mm02_00314039 predicted 941
9 SASI_Mm02_00314040 predicted 285
10 SASI_Mm02_00314041 predicted 284
11 SASI_Mm01_00116213 predicted 912
12 SASI_Mm01_00116214 predicted 704
13 SASI_Mm01_00116216 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000230
LEP MISSION shRNA Bacterial Glycerol Stock
leptin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000230.2-749s21c1
Sequence:CCGGATATATACACAGGATCCTATTCTCGAGAATAGGATCCTGTGTATATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000230.1-324s1c1
Sequence:CCGGCCTTCCAGAAACGTGATCCAACTCGAGTTGGATCACGTTTCTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000230.1-260s1c1
Sequence:CCGGCATCCTGACCTTATCCAAGATCTCGAGATCTTGGATAAGGTCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000230.1-225s1c1
Sequence:CCGGGTCACCGGTTTGGACTTCATTCTCGAGAATGAAGTCCAAACCGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000230.2-660s21c1
Sequence:CCGGTATCCAGGACTCTGTCAATTTCTCGAGAAATTGACAGAGTCCTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000230.2-289s21c1
Sequence:CCGGACACTGGCAGTCTACCAACAGCTCGAGCTGTTGGTAGACTGCCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000230
LEP MISSION shRNA shRNA Plasmid DNA
leptin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000230.2-749s21c1
Sequence:CCGGATATATACACAGGATCCTATTCTCGAGAATAGGATCCTGTGTATATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000230.1-324s1c1
Sequence:CCGGCCTTCCAGAAACGTGATCCAACTCGAGTTGGATCACGTTTCTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000230.1-260s1c1
Sequence:CCGGCATCCTGACCTTATCCAAGATCTCGAGATCTTGGATAAGGTCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000230.1-225s1c1
Sequence:CCGGGTCACCGGTTTGGACTTCATTCTCGAGAATGAAGTCCAAACCGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000230.2-660s21c1
Sequence:CCGGTATCCAGGACTCTGTCAATTTCTCGAGAAATTGACAGAGTCCTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000230.2-289s21c1
Sequence:CCGGACACTGGCAGTCTACCAACAGCTCGAGCTGTTGGTAGACTGCCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000230
LEP MISSION shRNA Lentiviral Transduction Particles
leptin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000230.2-749s21c1
Sequence:CCGGATATATACACAGGATCCTATTCTCGAGAATAGGATCCTGTGTATATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000230.1-324s1c1
Sequence:CCGGCCTTCCAGAAACGTGATCCAACTCGAGTTGGATCACGTTTCTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000230.1-260s1c1
Sequence:CCGGCATCCTGACCTTATCCAAGATCTCGAGATCTTGGATAAGGTCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000230.1-225s1c1
Sequence:CCGGGTCACCGGTTTGGACTTCATTCTCGAGAATGAAGTCCAAACCGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000230.2-660s21c1
Sequence:CCGGTATCCAGGACTCTGTCAATTTCTCGAGAAATTGACAGAGTCCTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000230.2-289s21c1
Sequence:CCGGACACTGGCAGTCTACCAACAGCTCGAGCTGTTGGTAGACTGCCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008493
LEP MISSION shRNA Bacterial Glycerol Stock
leptin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008493.3-2448s1c1
Sequence:CCGGCCCAAGTATAAACATGAAGTTCTCGAGAACTTCATGTTTATACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-92s1c1
Sequence:CCGGGCTTTGGTCCTATCTGTCTTACTCGAGTAAGACAGATAGGACCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-521s1c1
Sequence:CCGGGCAGGACATTCTTCAACAGTTCTCGAGAACTGTTGAAGAATGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-109s1c1
Sequence:CCGGCTTATGTTCAAGCAGTGCCTACTCGAGTAGGCACTGCTTGAACATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-538s1c1
Sequence:CCGGAGTTGGATGTTAGCCCTGAATCTCGAGATTCAGGGCTAACATCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008493
LEP MISSION shRNA shRNA Plasmid DNA
leptin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008493.3-2448s1c1
Sequence:CCGGCCCAAGTATAAACATGAAGTTCTCGAGAACTTCATGTTTATACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-92s1c1
Sequence:CCGGGCTTTGGTCCTATCTGTCTTACTCGAGTAAGACAGATAGGACCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-521s1c1
Sequence:CCGGGCAGGACATTCTTCAACAGTTCTCGAGAACTGTTGAAGAATGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-109s1c1
Sequence:CCGGCTTATGTTCAAGCAGTGCCTACTCGAGTAGGCACTGCTTGAACATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-538s1c1
Sequence:CCGGAGTTGGATGTTAGCCCTGAATCTCGAGATTCAGGGCTAACATCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008493
LEP MISSION shRNA Lentiviral Transduction Particles
leptin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008493.3-2448s1c1
Sequence:CCGGCCCAAGTATAAACATGAAGTTCTCGAGAACTTCATGTTTATACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-92s1c1
Sequence:CCGGGCTTTGGTCCTATCTGTCTTACTCGAGTAAGACAGATAGGACCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-521s1c1
Sequence:CCGGGCAGGACATTCTTCAACAGTTCTCGAGAACTGTTGAAGAATGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-109s1c1
Sequence:CCGGCTTATGTTCAAGCAGTGCCTACTCGAGTAGGCACTGCTTGAACATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008493.3-538s1c1
Sequence:CCGGAGTTGGATGTTAGCCCTGAATCTCGAGATTCAGGGCTAACATCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)