EMAIL THIS PAGE TO A FRIEND

LEPR

leptin receptor

113 Gene Product Result for
Synonyms: CD295 LEP-R LEPRD OB-R OBR
Gene ID:
Human(3953) Summary: The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
Mouse(16847) leptin receptor
Rat(24536) leptin receptor
sheep(443264) leptin receptor
naked mole-rat(101705981) leptin receptor
Zebrafish(567241) leptin receptor
dog(450207) leptin receptor
domestic cat(101085646) leptin receptor
cow(497205) leptin receptor
Horse(100033894) leptin receptor
chicken(374223) leptin receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0820 Mouse Lepr / Leptin Receptor ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002303 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003679 Rosetta Predictions human pricing
NM_001003680 Rosetta Predictions human pricing
NM_002303 siRNAs that have been validated in the lab human pricing
NM_012596 Rosetta Predictions rat pricing
NM_001122899 Rosetta Predictions mouse pricing
NM_010704 Rosetta Predictions mouse pricing
NM_146146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018254 predicted 2327
2 SASI_Hs01_00018255 predicted 1070
3 SASI_Hs01_00018256 predicted 841
4 SASI_Hs01_00018257 predicted 916
5 SASI_Hs01_00018258 predicted 2245
6 SASI_Hs02_00304309 predicted 1165
7 SASI_Hs01_00018262 predicted 1081
8 SASI_Hs02_00304310 predicted 238
9 SASI_Hs01_00018263 predicted 2029
10 SASI_Hs02_00304311 predicted 1189
11 SASI_Hs01_00018259 predicted 762
12 SASI_Hs01_00018260 predicted 1223
13 SASI_Hs01_00018261 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045409 predicted 2318
2 SASI_Hs01_00045410 predicted 1064
3 SASI_Hs01_00045411 predicted 845
4 SASI_Hs01_00045412 predicted 912
5 SASI_Hs01_00045413 predicted 2249
6 SASI_Hs02_00304312 predicted 1163
7 SASI_Hs01_00045417 predicted 1089
8 SASI_Hs02_00304313 predicted 234
9 SASI_Hs01_00045418 predicted 2028
10 SASI_Hs02_00304314 predicted 1182
11 SASI_Hs01_00045414 predicted 758
12 SASI_Hs01_00045415 predicted 1223
13 SASI_Hs01_00045416 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002303 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207424 validated 2322
1 SASI_Hs01_00207426 validated 840
1 SASI_Hs01_00207425 validated 1071
2 SASI_Hs01_00207427 predicted 919
3 SASI_Hs01_00207428 predicted 2248
4 SASI_Hs02_00333610 predicted 1161
5 SASI_Hs01_00207432 predicted 1080
6 SASI_Hs02_00333611 predicted 239
7 SASI_Hs01_00207433 predicted 2030
8 SASI_Hs02_00333612 predicted 1188
9 SASI_Hs01_00207429 predicted 755
10 SASI_Hs01_00207430 predicted 1227
11 SASI_Hs01_00207431 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035951 predicted 225
2 SASI_Rn01_00035953 predicted 1612
3 SASI_Rn02_00259743 predicted 932
4 SASI_Rn01_00035954 predicted 2478
5 SASI_Rn02_00259744 predicted 2362
6 SASI_Rn01_00035956 predicted 1978
7 SASI_Rn01_00035957 predicted 439
8 SASI_Rn02_00259745 predicted 2149
9 SASI_Rn01_00035958 predicted 1706
10 SASI_Rn02_00259746 predicted 525
11 SASI_Rn01_00035950 predicted 1176
12 SASI_Rn01_00035952 predicted 1379
13 SASI_Rn01_00035955 predicted 1781
14 SASI_Rn01_00035959 predicted 2708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309589 predicted 2431
2 SASI_Mm02_00309590 predicted 2460
3 SASI_Mm02_00309591 predicted 1334
4 SASI_Mm02_00309592 predicted 2956
5 SASI_Mm02_00309593 predicted 2298
6 SASI_Mm02_00309594 predicted 2350
7 SASI_Mm02_00309595 predicted 2243
8 SASI_Mm02_00309596 predicted 1754
9 SASI_Mm02_00309597 predicted 1687
10 SASI_Mm02_00309598 predicted 2622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104269 predicted 2429
2 SASI_Mm01_00104270 predicted 2460
3 SASI_Mm02_00319162 predicted 1333
4 SASI_Mm01_00104271 predicted 2958
5 SASI_Mm01_00104272 predicted 2299
6 SASI_Mm01_00104273 predicted 2352
7 SASI_Mm01_00104274 predicted 2245
8 SASI_Mm01_00104275 predicted 1749
9 SASI_Mm01_00104276 predicted 1688
10 SASI_Mm01_00104277 predicted 2627
11 SASI_Mm01_00104278 predicted 1920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116477 predicted 2424
2 SASI_Mm01_00116478 predicted 2457
3 SASI_Mm01_00116479 predicted 1338
4 SASI_Mm01_00116480 predicted 2959
5 SASI_Mm01_00116481 predicted 2299
6 SASI_Mm01_00116482 predicted 2353
7 SASI_Mm01_00116483 predicted 2246
8 SASI_Mm01_00116484 predicted 1754
9 SASI_Mm01_00116485 predicted 1688
10 SASI_Mm01_00116486 predicted 2624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010704
LEPR MISSION shRNA Bacterial Glycerol Stock
leptin receptor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010704.2-2225s21c1
Sequence:CCGGAGCCAGTCTTTCCGGAGAATACTCGAGTATTCTCCGGAAAGACTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010704.2-748s21c1
Sequence:CCGGGCAATTGTTGAAGCTAAATTTCTCGAGAAATTTAGCTTCAACAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010704.2-2400s21c1
Sequence:CCGGACTAGGATATTGGAGTAATTGCTCGAGCAATTACTCCAATATCCTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-2915s1c1
Sequence:CCGGCCCATCGAGAAATATCAGTTTCTCGAGAAACTGATATTTCTCGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-1637s1c1
Sequence:CCGGCCTGAGATACAGTACAGCATTCTCGAGAATGCTGTACTGTATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-880s1c1
Sequence:CCGGGCTAGGTGTAAACTGGGACATCTCGAGATGTCCCAGTTTACACCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-1308s1c1
Sequence:CCGGCGCTTCAATATCAGGTGAAATCTCGAGATTTCACCTGATATTGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-1914s1c1
Sequence:CCGGGCAGCCTGTATTGTCCTGATACTCGAGTATCAGGACAATACAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010704
LEPR MISSION shRNA shRNA Plasmid DNA
leptin receptor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010704.2-2225s21c1
Sequence:CCGGAGCCAGTCTTTCCGGAGAATACTCGAGTATTCTCCGGAAAGACTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000452718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010704.2-748s21c1
Sequence:CCGGGCAATTGTTGAAGCTAAATTTCTCGAGAAATTTAGCTTCAACAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010704.2-2400s21c1
Sequence:CCGGACTAGGATATTGGAGTAATTGCTCGAGCAATTACTCCAATATCCTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-2915s1c1
Sequence:CCGGCCCATCGAGAAATATCAGTTTCTCGAGAAACTGATATTTCTCGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-1637s1c1
Sequence:CCGGCCTGAGATACAGTACAGCATTCTCGAGAATGCTGTACTGTATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-880s1c1
Sequence:CCGGGCTAGGTGTAAACTGGGACATCTCGAGATGTCCCAGTTTACACCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-1308s1c1
Sequence:CCGGCGCTTCAATATCAGGTGAAATCTCGAGATTTCACCTGATATTGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-1914s1c1
Sequence:CCGGGCAGCCTGTATTGTCCTGATACTCGAGTATCAGGACAATACAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010704
LEPR MISSION shRNA Lentiviral Transduction Particles
leptin receptor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010704.2-2225s21c1
Sequence:CCGGAGCCAGTCTTTCCGGAGAATACTCGAGTATTCTCCGGAAAGACTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010704.2-748s21c1
Sequence:CCGGGCAATTGTTGAAGCTAAATTTCTCGAGAAATTTAGCTTCAACAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010704.2-2400s21c1
Sequence:CCGGACTAGGATATTGGAGTAATTGCTCGAGCAATTACTCCAATATCCTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-2915s1c1
Sequence:CCGGCCCATCGAGAAATATCAGTTTCTCGAGAAACTGATATTTCTCGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-1637s1c1
Sequence:CCGGCCTGAGATACAGTACAGCATTCTCGAGAATGCTGTACTGTATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-880s1c1
Sequence:CCGGGCTAGGTGTAAACTGGGACATCTCGAGATGTCCCAGTTTACACCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-1308s1c1
Sequence:CCGGCGCTTCAATATCAGGTGAAATCTCGAGATTTCACCTGATATTGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010704.1-1914s1c1
Sequence:CCGGGCAGCCTGTATTGTCCTGATACTCGAGTATCAGGACAATACAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002303
LEPR MISSION shRNA Bacterial Glycerol Stock
leptin receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-320s21c1
Sequence:CCGGTTATGTGATAACTGCGTTTAACTCGAGTTAAACGCAGTTATCACATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-951s21c1
Sequence:CCGGATGTCAGTTCAGCCCATAAATCTCGAGATTTATGGGCTGAACTGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-1579s21c1
Sequence:CCGGGTGAAACTGATGGGTACTTAACTCGAGTTAAGTACCCATCAGTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-916s21c1
Sequence:CCGGTCACATCTGGTGGAGTAATTTCTCGAGAAATTACTCCACCAGATGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-2771s1c1
Sequence:CCGGCCTGGGCACAAGGACTTAATTCTCGAGAATTAAGTCCTTGTGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-408s1c1
Sequence:CCGGGCAAGATAGAAACTGCTCCTTCTCGAGAAGGAGCAGTTTCTATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-2325s1c1
Sequence:CCGGGCCTATGAGCAAAGTAAATATCTCGAGATATTTACTTTGCTCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-1748s1c1
Sequence:CCGGCCAGTGTGAAAGCAGAAATTACTCGAGTAATTTCTGCTTTCACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-1102s1c1
Sequence:CCGGCGTGTCTTTACCACACAAGATCTCGAGATCTTGTGTGGTAAAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002303
LEPR MISSION shRNA shRNA Plasmid DNA
leptin receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-320s21c1
Sequence:CCGGTTATGTGATAACTGCGTTTAACTCGAGTTAAACGCAGTTATCACATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-951s21c1
Sequence:CCGGATGTCAGTTCAGCCCATAAATCTCGAGATTTATGGGCTGAACTGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-1579s21c1
Sequence:CCGGGTGAAACTGATGGGTACTTAACTCGAGTTAAGTACCCATCAGTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-916s21c1
Sequence:CCGGTCACATCTGGTGGAGTAATTTCTCGAGAAATTACTCCACCAGATGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-2771s1c1
Sequence:CCGGCCTGGGCACAAGGACTTAATTCTCGAGAATTAAGTCCTTGTGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-408s1c1
Sequence:CCGGGCAAGATAGAAACTGCTCCTTCTCGAGAAGGAGCAGTTTCTATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-2325s1c1
Sequence:CCGGGCCTATGAGCAAAGTAAATATCTCGAGATATTTACTTTGCTCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-1748s1c1
Sequence:CCGGCCAGTGTGAAAGCAGAAATTACTCGAGTAATTTCTGCTTTCACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-1102s1c1
Sequence:CCGGCGTGTCTTTACCACACAAGATCTCGAGATCTTGTGTGGTAAAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002303
LEPR MISSION shRNA Lentiviral Transduction Particles
leptin receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-320s21c1
Sequence:CCGGTTATGTGATAACTGCGTTTAACTCGAGTTAAACGCAGTTATCACATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-951s21c1
Sequence:CCGGATGTCAGTTCAGCCCATAAATCTCGAGATTTATGGGCTGAACTGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-1579s21c1
Sequence:CCGGGTGAAACTGATGGGTACTTAACTCGAGTTAAGTACCCATCAGTTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002303.4-916s21c1
Sequence:CCGGTCACATCTGGTGGAGTAATTTCTCGAGAAATTACTCCACCAGATGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-2771s1c1
Sequence:CCGGCCTGGGCACAAGGACTTAATTCTCGAGAATTAAGTCCTTGTGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-408s1c1
Sequence:CCGGGCAAGATAGAAACTGCTCCTTCTCGAGAAGGAGCAGTTTCTATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-2325s1c1
Sequence:CCGGGCCTATGAGCAAAGTAAATATCTCGAGATATTTACTTTGCTCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-1748s1c1
Sequence:CCGGCCAGTGTGAAAGCAGAAATTACTCGAGTAATTTCTGCTTTCACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002303.2-1102s1c1
Sequence:CCGGCGTGTCTTTACCACACAAGATCTCGAGATCTTGTGTGGTAAAGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)