EMAIL THIS PAGE TO A FRIEND

LEPREL1

leprecan-like 1

59 Gene Product Result for
Synonyms: MCVD MLAT4 P3H2
UniProtKB ID: Q8IVL5, B3KWI9, Q9NVI2
Gene ID:
Human(55214) Summary: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(210530) leprecan-like 1
Rat(288016) leprecan-like 1
sheep(101108618) leprecan-like 1
naked mole-rat(101709763) leprecan-like 1
Zebrafish(100034443) leprecan-like 1
cow(511799) leprecan-like 1
Horse(100059777) leprecan-like 1
domestic cat(101094873) leprecan-like 1
dog(478674) leprecan-like 1
chicken(414143) leprecan-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018192 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009921 MISSION® esiRNA esiRNA targeting human LEPREL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018192 Rosetta Predictions human pricing
NM_001025627 Rosetta Predictions rat pricing
NM_173379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351461 predicted 1456
2 SASI_Hs01_00151542 predicted 1135
3 SASI_Hs01_00151544 predicted 987
4 SASI_Hs01_00151545 predicted 1985
5 SASI_Hs01_00151546 predicted 832
6 SASI_Hs01_00151548 predicted 2231
7 SASI_Hs01_00151549 predicted 2003
8 SASI_Hs01_00151550 predicted 1314
9 SASI_Hs01_00151551 predicted 887
10 SASI_Hs02_00351462 predicted 1263
11 SASI_Hs01_00151543 predicted 1929
12 SASI_Hs01_00151547 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072996 predicted 1037
2 SASI_Rn01_00072997 predicted 1242
3 SASI_Rn01_00072998 predicted 824
4 SASI_Rn01_00072999 predicted 1234
5 SASI_Rn01_00073000 predicted 1648
6 SASI_Rn01_00073001 predicted 1925
7 SASI_Rn01_00073002 predicted 1307
8 SASI_Rn01_00073004 predicted 1988
9 SASI_Rn01_00073005 predicted 1432
10 SASI_Rn02_00203186 predicted 1428
11 SASI_Rn01_00073003 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149612 predicted 875
2 SASI_Mm01_00149613 predicted 1186
3 SASI_Mm01_00149614 predicted 775
4 SASI_Mm01_00149615 predicted 718
5 SASI_Mm01_00149616 predicted 1343
6 SASI_Mm01_00149617 predicted 1994
7 SASI_Mm01_00149618 predicted 753
8 SASI_Mm01_00149619 predicted 1705
9 SASI_Mm01_00149620 predicted 1342
10 SASI_Mm01_00149621 predicted 1989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018192
VALIDATED
LEPREL1 MISSION shRNA Bacterial Glycerol Stock
leprecan-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018192.3-1187s21c1
Sequence:CCGGGCTGGTCTGTATGAAGCTATTCTCGAGAATAGCTTCATACAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018192.3-1685s21c1
Sequence:CCGGCCCAAGATAGATCGAGACCTACTCGAGTAGGTCTCGATCTATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018192.3-1304s21c1
Sequence:CCGGCCTCTGCACTATGATTACCTACTCGAGTAGGTAATCATAGTGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018192.3-2125s21c1
Sequence:CCGGCCATGCTGACAACTGTTTGTTCTCGAGAACAAACAGTTGTCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018192.2-1993s1c1
Sequence:CCGGGCTTACACATTTCGAGACTATCTCGAGATAGTCTCGAAATGTGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018192.2-1495s1c1
Sequence:CCGGCCCAAGATAGATCGAGACCTACTCGAGTAGGTCTCGATCTATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018192.2-1935s1c1
Sequence:CCGGCCATGCTGACAACTGTTTGTTCTCGAGAACAAACAGTTGTCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018192.2-997s1c1
Sequence:CCGGGCTGGTCTGTATGAAGCTATTCTCGAGAATAGCTTCATACAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018192.2-1114s1c1
Sequence:CCGGCCTCTGCACTATGATTACCTACTCGAGTAGGTAATCATAGTGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018192
VALIDATED
LEPREL1 MISSION shRNA shRNA Plasmid DNA
leprecan-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018192.3-1187s21c1
Sequence:CCGGGCTGGTCTGTATGAAGCTATTCTCGAGAATAGCTTCATACAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018192.3-1685s21c1
Sequence:CCGGCCCAAGATAGATCGAGACCTACTCGAGTAGGTCTCGATCTATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018192.3-1304s21c1
Sequence:CCGGCCTCTGCACTATGATTACCTACTCGAGTAGGTAATCATAGTGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018192.3-2125s21c1
Sequence:CCGGCCATGCTGACAACTGTTTGTTCTCGAGAACAAACAGTTGTCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018192.2-1993s1c1
Sequence:CCGGGCTTACACATTTCGAGACTATCTCGAGATAGTCTCGAAATGTGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018192.2-1495s1c1
Sequence:CCGGCCCAAGATAGATCGAGACCTACTCGAGTAGGTCTCGATCTATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018192.2-1935s1c1
Sequence:CCGGCCATGCTGACAACTGTTTGTTCTCGAGAACAAACAGTTGTCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018192.2-997s1c1
Sequence:CCGGGCTGGTCTGTATGAAGCTATTCTCGAGAATAGCTTCATACAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018192.2-1114s1c1
Sequence:CCGGCCTCTGCACTATGATTACCTACTCGAGTAGGTAATCATAGTGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018192
VALIDATED
LEPREL1 MISSION shRNA Lentiviral Transduction Particles
leprecan-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018192.3-1187s21c1
Sequence:CCGGGCTGGTCTGTATGAAGCTATTCTCGAGAATAGCTTCATACAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018192.3-1685s21c1
Sequence:CCGGCCCAAGATAGATCGAGACCTACTCGAGTAGGTCTCGATCTATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018192.3-1304s21c1
Sequence:CCGGCCTCTGCACTATGATTACCTACTCGAGTAGGTAATCATAGTGCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018192.3-2125s21c1
Sequence:CCGGCCATGCTGACAACTGTTTGTTCTCGAGAACAAACAGTTGTCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018192.2-1993s1c1
Sequence:CCGGGCTTACACATTTCGAGACTATCTCGAGATAGTCTCGAAATGTGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018192.2-1495s1c1
Sequence:CCGGCCCAAGATAGATCGAGACCTACTCGAGTAGGTCTCGATCTATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018192.2-1935s1c1
Sequence:CCGGCCATGCTGACAACTGTTTGTTCTCGAGAACAAACAGTTGTCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018192.2-997s1c1
Sequence:CCGGGCTGGTCTGTATGAAGCTATTCTCGAGAATAGCTTCATACAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018192.2-1114s1c1
Sequence:CCGGCCTCTGCACTATGATTACCTACTCGAGTAGGTAATCATAGTGCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173379
LEPREL1 MISSION shRNA Bacterial Glycerol Stock
leprecan-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-907s1c1
Sequence:CCGGGCAGATCACTATATGCAGGTTCTCGAGAACCTGCATATAGTGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1207s1c1
Sequence:CCGGCGTCATAAACTTGAAGCTGAACTCGAGTTCAGCTTCAAGTTTATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1180s1c1
Sequence:CCGGCGGGAGGATTTAACAGCATTTCTCGAGAAATGCTGTTAAATCCTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1316s1c1
Sequence:CCGGGAGTCCCTTCAGGAGTGAATACTCGAGTATTCACTCCTGAAGGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1627s1c1
Sequence:CCGGGCACTCAAATTTGGTTATGAACTCGAGTTCATAACCAAATTTGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173379
LEPREL1 MISSION shRNA shRNA Plasmid DNA
leprecan-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-907s1c1
Sequence:CCGGGCAGATCACTATATGCAGGTTCTCGAGAACCTGCATATAGTGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1207s1c1
Sequence:CCGGCGTCATAAACTTGAAGCTGAACTCGAGTTCAGCTTCAAGTTTATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1180s1c1
Sequence:CCGGCGGGAGGATTTAACAGCATTTCTCGAGAAATGCTGTTAAATCCTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1316s1c1
Sequence:CCGGGAGTCCCTTCAGGAGTGAATACTCGAGTATTCACTCCTGAAGGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1627s1c1
Sequence:CCGGGCACTCAAATTTGGTTATGAACTCGAGTTCATAACCAAATTTGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173379
LEPREL1 MISSION shRNA Lentiviral Transduction Particles
leprecan-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-907s1c1
Sequence:CCGGGCAGATCACTATATGCAGGTTCTCGAGAACCTGCATATAGTGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1207s1c1
Sequence:CCGGCGTCATAAACTTGAAGCTGAACTCGAGTTCAGCTTCAAGTTTATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1180s1c1
Sequence:CCGGCGGGAGGATTTAACAGCATTTCTCGAGAAATGCTGTTAAATCCTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1316s1c1
Sequence:CCGGGAGTCCCTTCAGGAGTGAATACTCGAGTATTCACTCCTGAAGGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173379.1-1627s1c1
Sequence:CCGGGCACTCAAATTTGGTTATGAACTCGAGTTCATAACCAAATTTGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)