EMAIL THIS PAGE TO A FRIEND

LEPREL4

leprecan-like 4

45 Gene Product Result for
Synonyms: NO55 NOL55 SC65
UniProtKB ID: Q92791, Q53GI6, Q9H4F6
Gene ID:
Human(10609) Summary: This nucleolar protein was first characterized because it was an autoantigen in cases on interstitial cystitis. The protein, with a predicted molecular weight of 50 kDa, appears to be localized in the particulate compartment of the interphase nucleolus, with a distribution distinct from that of nucleolar protein B23. During mitosis it is associated with chromosomes. [provided by RefSeq, Jul 2008]
Mouse(66180) leprecan-like 4
Rat(59101) leprecan-like 4
sheep(101108671) leprecan-like 4
Domestic Rabbit(100345968) leprecan-like 4
naked mole-rat(101725606) leprecan-like 4
Zebrafish(570779) leprecan-like 4
dog(607731) leprecan-like 4
cow(788823) leprecan-like 4
domestic cat(101088892) leprecan-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU052891 MISSION® esiRNA esiRNA targeting mouse 1110036O03Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006455 Rosetta Predictions human pricing
NM_021581 Rosetta Predictions rat pricing
NM_176830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073602 predicted 1018
2 SASI_Hs01_00073603 predicted 1039
3 SASI_Hs01_00073604 predicted 1094
4 SASI_Hs01_00073605 predicted 812
5 SASI_Hs01_00073607 predicted 971
6 SASI_Hs01_00073608 predicted 896
7 SASI_Hs02_00341598 predicted 815
8 SASI_Hs01_00073609 predicted 953
9 SASI_Hs01_00073610 predicted 1060
10 SASI_Hs01_00073611 predicted 1465
11 SASI_Hs01_00073606 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116371 predicted 698
2 SASI_Rn01_00116372 predicted 1065
3 SASI_Rn01_00116373 predicted 638
4 SASI_Rn01_00116374 predicted 656
5 SASI_Rn01_00116375 predicted 507
6 SASI_Rn01_00116376 predicted 381
7 SASI_Rn01_00116377 predicted 1059
8 SASI_Rn02_00262611 predicted 831
9 SASI_Rn01_00116378 predicted 379
10 SASI_Rn01_00116379 predicted 1129
11 SASI_Rn01_00116380 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189484 predicted 886
2 SASI_Mm01_00189485 predicted 871
3 SASI_Mm01_00189486 predicted 1081
4 SASI_Mm01_00189487 predicted 1022
5 SASI_Mm01_00189488 predicted 973
6 SASI_Mm01_00189489 predicted 1241
7 SASI_Mm01_00189490 predicted 713
8 SASI_Mm01_00189491 predicted 788
9 SASI_Mm01_00189492 predicted 957
10 SASI_Mm01_00189493 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006455
VALIDATED
LEPREL4 MISSION shRNA Bacterial Glycerol Stock
leprecan-like 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006455.2-2048s21c1
Sequence:CCGGGATCACTTGAGGTCAGGAGTTCTCGAGAACTCCTGACCTCAAGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006455.2-1721s21c1
Sequence:CCGGCACACCTGTAATCCCAGCATTCTCGAGAATGCTGGGATTACAGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006455.2-338s21c1
Sequence:CCGGGCAGTACGAGAAGTACAGCTTCTCGAGAAGCTGTACTTCTCGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006455.2-1668s21c1
Sequence:CCGGGCAGCAGCAAGAACTATTTATCTCGAGATAAATAGTTCTTGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-1668s1c1
Sequence:CCGGGCAGCAGCAAGAACTATTTATCTCGAGATAAATAGTTCTTGCTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006455.2-338s1c1
Sequence:CCGGGCAGTACGAGAAGTACAGCTTCTCGAGAAGCTGTACTTCTCGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-1721s1c1
Sequence:CCGGCACACCTGTAATCCCAGCATTCTCGAGAATGCTGGGATTACAGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-1404s1c1
Sequence:CCGGCACATGTACCTGCAGTCAGATCTCGAGATCTGACTGCAGGTACATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006455.2-339s1c1
Sequence:CCGGCAGTACGAGAAGTACAGCTTCCTCGAGGAAGCTGTACTTCTCGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-2048s1c1
Sequence:CCGGGATCACTTGAGGTCAGGAGTTCTCGAGAACTCCTGACCTCAAGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006455.2-1277s1c1
Sequence:CCGGGAACCTGGTGTATTACCGGTTCTCGAGAACCGGTAATACACCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006455
VALIDATED
LEPREL4 MISSION shRNA shRNA Plasmid DNA
leprecan-like 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006455.2-2048s21c1
Sequence:CCGGGATCACTTGAGGTCAGGAGTTCTCGAGAACTCCTGACCTCAAGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006455.2-1721s21c1
Sequence:CCGGCACACCTGTAATCCCAGCATTCTCGAGAATGCTGGGATTACAGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006455.2-338s21c1
Sequence:CCGGGCAGTACGAGAAGTACAGCTTCTCGAGAAGCTGTACTTCTCGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006455.2-1668s21c1
Sequence:CCGGGCAGCAGCAAGAACTATTTATCTCGAGATAAATAGTTCTTGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-1668s1c1
Sequence:CCGGGCAGCAGCAAGAACTATTTATCTCGAGATAAATAGTTCTTGCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006455.2-338s1c1
Sequence:CCGGGCAGTACGAGAAGTACAGCTTCTCGAGAAGCTGTACTTCTCGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-1721s1c1
Sequence:CCGGCACACCTGTAATCCCAGCATTCTCGAGAATGCTGGGATTACAGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-1404s1c1
Sequence:CCGGCACATGTACCTGCAGTCAGATCTCGAGATCTGACTGCAGGTACATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006455.2-339s1c1
Sequence:CCGGCAGTACGAGAAGTACAGCTTCCTCGAGGAAGCTGTACTTCTCGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-2048s1c1
Sequence:CCGGGATCACTTGAGGTCAGGAGTTCTCGAGAACTCCTGACCTCAAGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006455.2-1277s1c1
Sequence:CCGGGAACCTGGTGTATTACCGGTTCTCGAGAACCGGTAATACACCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006455
VALIDATED
LEPREL4 MISSION shRNA Lentiviral Transduction Particles
leprecan-like 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006455.2-2048s21c1
Sequence:CCGGGATCACTTGAGGTCAGGAGTTCTCGAGAACTCCTGACCTCAAGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006455.2-1721s21c1
Sequence:CCGGCACACCTGTAATCCCAGCATTCTCGAGAATGCTGGGATTACAGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006455.2-338s21c1
Sequence:CCGGGCAGTACGAGAAGTACAGCTTCTCGAGAAGCTGTACTTCTCGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006455.2-1668s21c1
Sequence:CCGGGCAGCAGCAAGAACTATTTATCTCGAGATAAATAGTTCTTGCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-1668s1c1
Sequence:CCGGGCAGCAGCAAGAACTATTTATCTCGAGATAAATAGTTCTTGCTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006455.2-338s1c1
Sequence:CCGGGCAGTACGAGAAGTACAGCTTCTCGAGAAGCTGTACTTCTCGTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-1721s1c1
Sequence:CCGGCACACCTGTAATCCCAGCATTCTCGAGAATGCTGGGATTACAGGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-1404s1c1
Sequence:CCGGCACATGTACCTGCAGTCAGATCTCGAGATCTGACTGCAGGTACATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006455.2-339s1c1
Sequence:CCGGCAGTACGAGAAGTACAGCTTCCTCGAGGAAGCTGTACTTCTCGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006455.2-2048s1c1
Sequence:CCGGGATCACTTGAGGTCAGGAGTTCTCGAGAACTCCTGACCTCAAGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006455.2-1277s1c1
Sequence:CCGGGAACCTGGTGTATTACCGGTTCTCGAGAACCGGTAATACACCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176830
VALIDATED
LEPREL4 MISSION shRNA Bacterial Glycerol Stock
leprecan-like 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-714s21c1
Sequence:CCGGCCGCCAAGTATCTCAACTACTCTCGAGAGTAGTTGAGATACTTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-1361s21c1
Sequence:CCGGCCTGAAGAACCTCTATCTGATCTCGAGATCAGATAGAGGTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-1288s21c1
Sequence:CCGGGCTAGACTTCACACACATGTACTCGAGTACATGTGTGTGAAGTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-1166s21c1
Sequence:CCGGATGCAGCAGAACCTGGTATATCTCGAGATATACCAGGTTCTGCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176830.2-1717s21c1
Sequence:CCGGGTGTGGCATCACATGCCTTTACTCGAGTAAAGGCATGTGATGCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-1361s1c1
Sequence:CCGGCCTGAAGAACCTCTATCTGATCTCGAGATCAGATAGAGGTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-714s1c1
Sequence:CCGGCCGCCAAGTATCTCAACTACTCTCGAGAGTAGTTGAGATACTTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-1288s1c1
Sequence:CCGGGCTAGACTTCACACACATGTACTCGAGTACATGTGTGTGAAGTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-875s1c1
Sequence:CCGGGCTGAATATATGACGGTCTTTCTCGAGAAAGACCGTCATATATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176830.2-1673s1c1
Sequence:CCGGCCAGGCTACATAATGAGATTTCTCGAGAAATCTCATTATGTAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176830
VALIDATED
LEPREL4 MISSION shRNA shRNA Plasmid DNA
leprecan-like 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-714s21c1
Sequence:CCGGCCGCCAAGTATCTCAACTACTCTCGAGAGTAGTTGAGATACTTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-1361s21c1
Sequence:CCGGCCTGAAGAACCTCTATCTGATCTCGAGATCAGATAGAGGTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-1288s21c1
Sequence:CCGGGCTAGACTTCACACACATGTACTCGAGTACATGTGTGTGAAGTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-1166s21c1
Sequence:CCGGATGCAGCAGAACCTGGTATATCTCGAGATATACCAGGTTCTGCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176830.2-1717s21c1
Sequence:CCGGGTGTGGCATCACATGCCTTTACTCGAGTAAAGGCATGTGATGCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-1361s1c1
Sequence:CCGGCCTGAAGAACCTCTATCTGATCTCGAGATCAGATAGAGGTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-714s1c1
Sequence:CCGGCCGCCAAGTATCTCAACTACTCTCGAGAGTAGTTGAGATACTTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-1288s1c1
Sequence:CCGGGCTAGACTTCACACACATGTACTCGAGTACATGTGTGTGAAGTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-875s1c1
Sequence:CCGGGCTGAATATATGACGGTCTTTCTCGAGAAAGACCGTCATATATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176830.2-1673s1c1
Sequence:CCGGCCAGGCTACATAATGAGATTTCTCGAGAAATCTCATTATGTAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176830
VALIDATED
LEPREL4 MISSION shRNA Lentiviral Transduction Particles
leprecan-like 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-714s21c1
Sequence:CCGGCCGCCAAGTATCTCAACTACTCTCGAGAGTAGTTGAGATACTTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-1361s21c1
Sequence:CCGGCCTGAAGAACCTCTATCTGATCTCGAGATCAGATAGAGGTTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-1288s21c1
Sequence:CCGGGCTAGACTTCACACACATGTACTCGAGTACATGTGTGTGAAGTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176830.2-1166s21c1
Sequence:CCGGATGCAGCAGAACCTGGTATATCTCGAGATATACCAGGTTCTGCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176830.2-1717s21c1
Sequence:CCGGGTGTGGCATCACATGCCTTTACTCGAGTAAAGGCATGTGATGCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-1361s1c1
Sequence:CCGGCCTGAAGAACCTCTATCTGATCTCGAGATCAGATAGAGGTTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-714s1c1
Sequence:CCGGCCGCCAAGTATCTCAACTACTCTCGAGAGTAGTTGAGATACTTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-1288s1c1
Sequence:CCGGGCTAGACTTCACACACATGTACTCGAGTACATGTGTGTGAAGTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176830.2-875s1c1
Sequence:CCGGGCTGAATATATGACGGTCTTTCTCGAGAAAGACCGTCATATATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176830.2-1673s1c1
Sequence:CCGGCCAGGCTACATAATGAGATTTCTCGAGAAATCTCATTATGTAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)